Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
TG1540 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034666 | Caenorhabditis elegans | gen-1(tm2940) III. | Reference: Bailly AP, et al. PLoS Genet. 2010 Jul 15;6(7):e1001025. Agostinho A, et al. PLos Genetics 2013. | WBGene00020442(gen-1) | WBGene00020442(gen-1) | WB-STRAIN:WBStrain00034666 | WormBase (WB) | WB | available | WB-STRAIN:TG1540, CGC_TG1540 | 2026-08-15 09:32:43 | 1 | |||
|
TH214 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034746 | Caenorhabditis elegans | unc-119(ed3) III; ddIs128. | ddIs128 [ify-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org) | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034746 | WormBase (WB) | WB | available | WB-STRAIN:TH214, CGC_TH214 | 2026-08-15 09:32:43 | 1 | |||
|
TH66 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034719 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00004027(pie-1) | WBGene00004027(pie-1) | WB-STRAIN:WBStrain00034719 | WormBase (WB) | WB | unknown | PMID:31645459 | WB-STRAIN:TH66 | 2026-08-15 09:32:43 | 1 | ||
|
TH246 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034771 | Caenorhabditis elegans | unc-119(ed3) III; ddIs159. | ddIs159 [arx-2::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org) | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034771 | WormBase (WB) | WB | available | WB-STRAIN:TH246, CGC_TH246 | 2026-08-15 09:32:45 | 2 | |||
|
TH502 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034806 | Caenorhabditis elegans | unc-119(ed3) III; ddIs290. | ddIs290 [sax-7::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)|"WBStrain provided so WBPaper00060449 paper added based on AFP_Strain data." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034806 | WormBase (WB) | WB | available | PMID:38964319 | WB-STRAIN:TH502, CGC_TH502 | 2026-08-15 09:32:44 | 1 | ||
|
TJ356 Resource Report Resource Website 10+ mentions |
RRID:WB-STRAIN:WBStrain00034892 | Caenorhabditis elegans | zIs356 [daf-16p::daf-16a/b::GFP+rol-6(su1006)] | Alt genotype from publication : [daf-16p::daf-16a/b::GFP + rol-6(su1006)]|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain."|"Mutagen:Gamma rays"|"Reference WBPaper00054805 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00057259 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058750 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00059256 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype (zIs356[daf-16p::daf-16a/b::GFP + rol-6(su1006)])"|"Supplementary_genotype (zIs356[daf-16p::daf-16a/b::GFP + rol-6])"|"Supplementary_genotype daf-16p::daf-16a/b::GFP zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]"|"Supplementary_genotype zIs356 V [daf-16p::daf-16::gfp + rol-6(su1006)]"|"Supplementary_genotype zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]"|"Supplementary_genotype [daf-16p::daf-16a/b::GFP + rol-6(su1006) II.]"|"WBStrain mapped, WBPaper00059685 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060064 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060204 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060824 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060896 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061006 added based on AFP_Strain data."|"WBStrain provided so WBPaper00049531 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00059548 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00059721 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00059884 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00059960 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060133 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060134 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060223 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060410 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060420 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060449 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060456 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060484 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060486 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060487 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060495 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060545 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060602 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060669 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060692 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060708 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060742 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060778 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060797 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060809 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060840 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060850 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060924 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060976 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061045 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061102 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061130 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061159 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061236 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061243 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061245 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061297 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061313 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061319 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061385 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061396 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061436 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061452 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061495 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061547 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061583 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061584 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061624 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061641 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061646 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061671 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061698 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061738 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061748 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061750 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061786 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061791 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061836 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061837 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061852 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061869 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061870 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061871 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061890 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061895 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061902 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061904 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061915 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061925 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061938 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061998 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062031 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062037 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062064 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062068 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062084 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062091 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062110 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062125 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062141 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062146 paper added based on AFP_Strain data."|"zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson. Correspondence: [email protected]. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects."|"zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson?. ?Correspondence: [email protected]. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145." | WBGene00000912(daf-16)|WBGene00004397(rol-6) | WBGene00000912(daf-16), WBGene00004397(rol-6) | WB-STRAIN:WBStrain00034892 | WormBase (WB) | WB | available | PMID:29956725 PMID:31432005 PMID:31645584 PMID:32010481 PMID:32289633 PMID:32453327 PMID:32535316 PMID:32707947 PMID:32768194 PMID:32875367 PMID:32163353 PMID:33319173 PMID:33382195 PMID:33471780 PMID:33159585 PMID:33809299 PMID:33883621 PMID:33956916 PMID:34449775 PMID:34505574 PMID:33851304 PMID:34544019 PMID:34607947 PMID:34634043 PMID:34648748 PMID:36626986 PMID:36794357 PMID:37118502 PMID:37122724 PMID:37440595 PMID:37454110 PMID:37500972 PMID:37639584 PMID:37704756 PMID:37726773 PMID:37422249 PMID:37910615 PMID:38378098 PMID:38532074 PMID:38632209 PMID:38746662 PMID:38754743 PMID:39273603 PMID:39731224 PMID:39708289 |
WB-STRAIN:TJ356, CGC_TJ356 | 2026-08-15 09:32:46 | 24 | ||
|
TJ375 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034895 | Caenorhabditis elegans | gpIs1. | gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Insertion not mapped.|"Made_by: Henderson and Link"|"Mutagen:Gamma Rays"|"Reference WBPaper00054805 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00057259 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058621 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058626 added based on published strain data identified by Textpresso literature search."|"WBStrain provided so WBPaper00060410 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061585 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061805 paper added based on AFP_Strain data." | WBGene00002016(hsp-16.2) | WBGene00002016(hsp-16.2) | WB-STRAIN:WBStrain00034895 | WormBase (WB) | WB | available | PMID:29956725 PMID:31432005 PMID:31510078 PMID:31331055 PMID:32535316 PMID:32707947 PMID:33006972 PMID:33183600 PMID:33809299 PMID:34196492 PMID:34407398 PMID:35045336 PMID:37416472 PMID:37254351 PMID:37443152 PMID:38852157 PMID:39273603 |
WB-STRAIN:TJ375, CGC_TJ375 | 2026-08-15 09:32:46 | 3 | ||
|
TP12 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034928 | Caenorhabditis elegans | kaIs12[col-19::GFP] | kaIs12 [col-19::GFP]. Collagen COL-19 with GFP fused to C-terminus localized in the cuticle.|"Made_by: M. Thein"|"Mutagen:Gamma rays"|"WBStrain mapped, WBPaper00060738 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061220 added based on AFP_Strain data." | WBGene00000608(col-19) | WBGene00000608(col-19) | WB-STRAIN:WBStrain00034928 | WormBase (WB) | WB | available | PMID:33289480 PMID:33789349 PMID:38177158 PMID:38378098 |
WB-STRAIN:TP12, CGC_TP12 | 2026-08-15 09:32:46 | 2 | ||
|
TJ1060 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034903 | Caenorhabditis elegans | spe-9(hc88) I; rrf-3(b26) II. | Made_by: T. Fabian|"Supplementary_genotype spe-9(hc88) I; rrf-3(b26) II"|"Supplementary_genotype [spe-9(hc88)]"|"Temperature sensitive. Maintain at 15C. See also WBPaper00002184." | WBGene00004510(rrf-3)|WBGene00004963(spe-9) | WBGene00004510(rrf-3), WBGene00004963(spe-9) | WB-STRAIN:WBStrain00034903 | WormBase (WB) | WB | available | PMID:8303273 PMID:7973641 PMID:8583834 PMID:11708615 PMID:37175557 PMID:37644339 PMID:37884488 PMID:38177158 |
WB-STRAIN:TJ1060, CGC_TJ1060 | 2026-08-15 09:32:46 | 3 | ||
|
TK22 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034909 | Caenorhabditis elegans | mev-1(kn1) III. | Methylviologen (paraquat) sensitive. Oxygen sensitive. Short life span.|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype mev-1(kn1) III" | WBGene00003225(mev-1) | WBGene00003225(mev-1) | WB-STRAIN:WBStrain00034909 | WormBase (WB) | WB | available | PMID:31717869 PMID:32009302 PMID:33542359 PMID:33883621 PMID:36774344 PMID:37427543 PMID:37957360 PMID:38790689 |
WB-STRAIN:TK22, CGC_TK22 | 2026-08-15 09:32:46 | 5 | ||
|
TR2171 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034950 | Caenorhabditis elegans | unc-68(r1162) V. | Homozygous viable Unc. Males do not mate.|"Reference WBPaper00056839 added based on published strain data identified by Textpresso literature search."|"WBStrain provided so WBPaper00061245 paper added based on AFP_Strain data." | WBGene00006801(unc-68) | WBGene00006801(unc-68) | WB-STRAIN:WBStrain00034950 | WormBase (WB) | WB | available | PMID:31162948 PMID:33820857 |
WB-STRAIN:TR2171, CGC_TR2171 | 2026-08-15 09:32:47 | 3 | ||
|
TQ194 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034931 | Caenorhabditis elegans | trp-2(sy691) III. | Mutagen:UV/TMP | WBGene00006615(trp-2) | WBGene00006615(trp-2) | WB-STRAIN:WBStrain00034931 | WormBase (WB) | WB | available | PMID:37155851 | WB-STRAIN:TQ194, CGC_TQ194 | 2026-08-15 09:32:46 | 2 | ||
|
TQ1828 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034936 | Caenorhabditis elegans | pde-1(nj57) pde-5(nj49) I; pde-3(nj59) II; pde-2(tm3098) III. | Maintain under normal conditions. Reference: Liu J, et al (2010) Nature Neurosci 13:715-22.|"Mutagen:TMP+UV"|"Mutagen:TMP/UV" | WBGene00008443(pde-3)|WBGene00011146(pde-2)|WBGene00011433(pde-1)|WBGene00016328(pde-5) | WBGene00008443(pde-3), WBGene00011146(pde-2), WBGene00011433(pde-1), WBGene00016328(pde-5) | WB-STRAIN:WBStrain00034936 | WormBase (WB) | WB | available | WB-STRAIN:TQ1828, CGC_TQ1828 | 2026-08-15 09:32:46 | 4 | |||
|
TU1366 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035044 | Caenorhabditis elegans | deg-1(u506) X. | Recessive gain-of-function. Codon 393 changed from alanine (GCT) to threonine (ACT). Deg and Tab at all temperatures. Lethal at 15C (embryos arrest at the two-fold stage, larvae survive). | WBGene00000950(deg-1) | WBGene00000950(deg-1) | WB-STRAIN:WBStrain00035044 | WormBase (WB) | WB | available | PMID:7627559 | WB-STRAIN:TU1366, CGC_TU1366 | 2026-08-15 09:32:48 | 1 | ||
|
TU3311 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035055 | Caenorhabditis elegans | uls60 [unc-119p::YFP+unc-119p::sid-1] | Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"Made_by: Calixto & Topalidou"|"uIs60 [unc-119p::YFP + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. YFP detectable in neurons. Maintain 15-20 degrees. Reference: Calixto et al. (2010) Nature Methods 7:554-9."|"WBStrain provided so WBPaper00060459 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060797 paper added based on AFP_Strain data." | WB-STRAIN:WBStrain00035055 | WormBase (WB) | WB | available | PMID:33319173 PMID:38378098 |
WB-STRAIN:TU3311, CGC_TU3311 | 2026-08-15 09:32:48 | 6 | ||||
|
TU3403 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035058 | Caenorhabditis elegans | ccIs4251 I; sid-1(qt2) V; uIs71. | ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. uIs71 [(pCFJ90) myo-2p::mCherry + mec-18p::sid-1]. TRN-specific feeding RNAi. Reference: Calixto et al. (2010) Nature Methods 7:554-9.|"Supplementary_genotype ccIs4251 ((pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)) Isid-1 (qt2) V uIs71 ((pCFJ90) myo-2p::mCherry + mec-18p::sid-1)" | WBGene00004795(sid-1) | WBGene00004795(sid-1) | WB-STRAIN:WBStrain00035058 | WormBase (WB) | WB | available | PMID:37857834 | WB-STRAIN:TU3403, CGC_TU3403 | 2026-08-15 09:32:48 | 1 | ||
|
TU3401 Resource Report Resource Website 10+ mentions |
RRID:WB-STRAIN:WBStrain00035057 | Caenorhabditis elegans | sid-1(pk3321);uIs69 | no longer available from the CGC.|"Supplementary_genotype sid-1(pk3321) V; uIs69 [pCFJ90 (myo-2p::mCherry) + unc-119p::sid-1] V"|"uIs69 [pCFJ90 (myo-2p::mCherry) + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. Maintain 15-20 degrees. [NOTE: uIs69 is closely linked and maps to the right of dpy-11. (C. Loer 08/2011) See strains LC105 and LC108.] Reference: Calixto et al. (2010) Nature Methods 7:554-9."|"WBStrain mapped, WBPaper00061562 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060797 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061750 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061894 paper added based on AFP_Strain data." | WBGene00004795(sid-1) | WBGene00004795(sid-1) | WB-STRAIN:WBStrain00035057 | WormBase (WB) | WB | available | PMID:33674585 PMID:34172445 PMID:34321666 PMID:34496255 PMID:36653384 PMID:37118550 PMID:37118502 PMID:37432924 PMID:37651423 PMID:37722055 PMID:38446031 PMID:38510643 PMID:38740431 PMID:39395417 PMID:39423228 |
WB-STRAIN:TU3401, CGC_TU3401 | 2026-08-15 09:32:48 | 12 | ||
|
TU38 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035030 | Caenorhabditis elegans | deg-1(u38) X. | Touch insensitive-at the tail. Degeneration of a small set of neurons. TAB Touch ABnormal). | WBGene00000950(deg-1) | WBGene00000950(deg-1) | WB-STRAIN:WBStrain00035030 | WormBase (WB) | WB | available | PMID:2342572 PMID:32009302 PMID:37500635 PMID:38443452 |
WB-STRAIN:TU38, CGC_TU38 | 2026-08-15 09:32:48 | 2 | ||
|
TU166 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035034 | Caenorhabditis elegans | mec-8(u314) I. | Reference: Lundquist and Herman 1994 Genetics 138: 83. | WBGene00003172(mec-8) | WBGene00003172(mec-8) | WB-STRAIN:WBStrain00035034 | WormBase (WB) | WB | available | WB-STRAIN:TU166, CGC_TU166 | 2026-08-15 09:32:48 | 1 | |||
|
TRG1477 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035009 | Caenorhabditis elegans | unc-119(ed3);tag_1477[WRM062A_D04(pRedFlp-Hgr)(C50B6.11[22755]::S0001_pR6K_Amp_2xTY1ce_EGFP_FRT_rpsl_neo_FRT_3xFlag)dFRT::unc-119-Nat] | Imported directly from the transgeneOme database. | WBGene00008223(lgc-48) | WBGene00008223(lgc-48) | WB-STRAIN:WBStrain00035009 | WormBase (WB) | WB | unknown | WB-STRAIN:TRG1477 | 2026-08-15 09:32:48 | 1 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.