Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
OP563 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030334 | Caenorhabditis elegans | unc-119(tm4063) III; wgIs563. | Made_by: DKV/RJT/PW|"Modern strain"|"wgIs563 [cebp-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00030334 | WormBase (WB) | WB | available | WB-STRAIN:OP563, CGC_OP563 | 2026-08-15 09:31:17 | 2 | |||
|
PD2218 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030557 | Caenorhabditis elegans | ccTi1594 umnIs7 III. | ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.|"Supplementary_genotype ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III" | WB-STRAIN:WBStrain00030557 | WormBase (WB) | WB | available | PMID:37878696 | WB-STRAIN:PD2218, CGC_PD2218 | 2026-08-15 09:31:21 | 1 | ||||
|
PD1594 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030555 | Caenorhabditis elegans | ccTi1594 unc-119(ed3) III. | ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. GFP expression in germline. Transgene rescues unc-119(ed3). Improved GPR-1 over-expression transgene appears to be stably expressed in the germline at a wide range of temperatures and does not require special handling. (unlike other GPR-1 overexpressing transgenes previously described in the literature). The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance. Neomycin resistant. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.|"Made_by: Christian Froekjaer Jensen" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00030555 | WormBase (WB) | WB | available | WB-STRAIN:PD1594, CGC_PD1594 | 2026-08-15 09:31:21 | 1 | |||
|
PD2217 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030556 | Caenorhabditis elegans | ccTi1594 unc-119(ed3) III; hjSi20 IV. | ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. hjSi20 [myo-2p::mCherry::unc-54 3'UTR] IV. GFP expression in germline. mCherry expression in pharynx. The ccTi1594 transgene rescues unc-119(ed3). High penetrance of non-Mendelian inheritance. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00030556 | WormBase (WB) | WB | available | PMID:38946472 | WB-STRAIN:PD2217, CGC_PD2217 | 2026-08-15 09:31:21 | 2 | ||
|
PD1074 Resource Report Resource Website 10+ mentions |
RRID:WB-STRAIN:WBStrain00030553 | Caenorhabditis elegans | EMPTY | A defined and recently cloned population of animals derived from the original Bristol variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenners original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. PD1074 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. PD1074 is intended to be used as a wild type reference strain with the closely matched genome assembly of Yoshimura et al (ref) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). We note that PD1074 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in PD1074. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura et al (ref).|"A defined and recently cloned population of animals derived from the original Bristol variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenners original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. PD1074 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. PD1074 is intended to be used as a wild type reference strain with the closely matched genome assembly of Yoshimura, et al. (Genome Res. 2019 Jun;29(6):1009-1022) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). We note that PD1074 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in PD1074. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura, et al, (2019)."|"Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild."|"Made_by: Karen Artiles & Mark Edgley"|"no longer available from the CGC."|"Supplementary_genotype"|"WBStrain provided so WBPaper00061243 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061573 paper added based on AFP_Strain data." | WB-STRAIN:WBStrain00030553 | WormBase (WB) | WB | unknown | PMID:33313486 PMID:33458604 PMID:33693840 PMID:34156835 PMID:37008729 PMID:36595469 PMID:37170380 PMID:37590248 PMID:37777524 PMID:38596360 PMID:38488606 PMID:38771761 PMID:39712935 |
WB-STRAIN:PD1074 | 2026-08-15 09:31:21 | 11 | ||||
|
PD4793 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030592 | Caenorhabditis elegans | mIs10 V. | mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. Suppresses recombination between unc-60 and dpy-11. See WBG 15 #5 page 20. | WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00017698(F22B7.9) | WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00017698(F22B7.9) | WB-STRAIN:WBStrain00030592 | WormBase (WB) | WB | available | PMID:32434424 PMID:37067863 |
WB-STRAIN:PD4793, CGC_PD4793 | 2026-08-15 09:31:22 | 2 | ||
|
PD4251 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030574 | Caenorhabditis elegans | ccIs4251 I; dpy-20(e1282) IV. | ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. This strain produces GFP in all body wall muscles and vulval muscles, with a combination of mitochondrial and nuclear localization. ME0. Heterozygous males mate well. Integrated array (ccIs4251) contains 3 plasmids: pSAK2 (myo-3 promoter driving a nuclear-targeted GFP-LacZ fusion), pSAK4 (myo-3 promoter driving motochondrially targeted GFP), and a dpy-20 subclone. Array rescues dpy-20(e1282ts).|"WBStrain mapped, WBPaper00061072 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061110 added based on AFP_Strain data." | WBGene00001079(dpy-20) | WBGene00001079(dpy-20) | WB-STRAIN:WBStrain00030574 | WormBase (WB) | WB | available | PMID:9486653 PMID:31769755 PMID:33602504 PMID:33654835 PMID:37043428 PMID:37432924 PMID:38799035 PMID:39420966 PMID:39612872 |
WB-STRAIN:PD4251, CGC_PD4251 | 2026-08-15 09:31:22 | 6 | ||
|
PD4285 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030575 | Caenorhabditis elegans | mls-1(cc569) III; ayIs2 IV. | ayIs2 [egl-15p::GFP + dpy-20(+)] IV. Adult midbody GFP pattern in 8 vm-1 type muscles (instead of 4 as in WT). mls-1(o) converts uterine to vulval muscles. | WBGene00003376(mls-1) | WBGene00003376(mls-1) | WB-STRAIN:WBStrain00030575 | WormBase (WB) | WB | available | WB-STRAIN:PD4285, CGC_PD4285 | 2026-08-15 09:31:22 | 1 | |||
|
PD4666 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030587 | Caenorhabditis elegans | ayIs6 X. | ayIs6 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background.|"Supplementary_genotype ayIs6 [hlh-8::GFP fusion + dpy-20(+)] X" | WBGene00001953(hlh-8) | WBGene00001953(hlh-8) | WB-STRAIN:WBStrain00030587 | WormBase (WB) | WB | available | PMID:37651423 PMID:37310364 |
WB-STRAIN:PD4666, CGC_PD4666 | 2026-08-15 09:31:22 | 2 | ||
|
PFR60 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030671 | Caenorhabditis elegans | hpl-1(tm1624) X. | Wild type phenotype. | WBGene00001995(hpl-1) | WBGene00001995(hpl-1) | WB-STRAIN:WBStrain00030671 | WormBase (WB) | WB | available | WB-STRAIN:PFR60, CGC_PFR60 | 2026-08-15 09:31:23 | 1 | |||
|
PD8120 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030609 | Caenorhabditis elegans | smg-1(cc546) I. | Made_by: Getz and Fire|"Reference WBPaper00058995 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype smg-1(cc546)"|"Supplementary_genotype smg-1(cc546) I"|"Temperature sensitive. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]"|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data." | WBGene00004879(smg-1) | WBGene00004879(smg-1) | WB-STRAIN:WBStrain00030609 | WormBase (WB) | WB | available | PMID:31882874 PMID:32302543 PMID:37728486 PMID:37936921 |
WB-STRAIN:PD8120, CGC_PD8120 | 2026-08-15 09:31:22 | 1 | ||
|
PE255 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030634 | Caenorhabditis elegans | feIs5 X. | feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.|"WBStrain mapped, WBPaper00059997 added based on AFP_Strain data." | WB-STRAIN:WBStrain00030634 | WormBase (WB) | WB | available | PMID:32687264 PMID:33188857 PMID:38594249 PMID:39519157 |
WB-STRAIN:PE255, CGC_PE255 | 2026-08-15 09:31:23 | 2 | ||||
|
PE219 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030632 | Caenorhabditis elegans | dab-1(gk291) II; feEx43. | feEx43 [dab-1::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Holmes et al. J Cell Sci. 2007 Aug 1;120(Pt 15):2741-51. | WBGene00000894(dab-1) | WBGene00000894(dab-1) | WB-STRAIN:WBStrain00030632 | WormBase (WB) | WB | available | WB-STRAIN:PE219, CGC_PE219 | 2026-08-15 09:31:23 | 1 | |||
|
SA250 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033888 | Caenorhabditis elegans | tjIs54; tjIs57. | Supplementary_genotype GFP-TBB-2; mCherry TBG-1; tjIs54 [pie-1p:GFP:tbb-2 + pie-1p:2xmCherry:tbg-1 + unc-119(+)]. tjIs57 [pie-1p:mCherry:his-48 + unc-119(+)]|"Supplementary_genotype jIs54[pie-1p::GFP::tbb-2 + pie-1p::2xmCherry::tbg-1 + unc-119(+)]; tjIs57[pie1p::mCherry::his-48 + unc119(+)]"|"Supplementary_genotype unc-119(ed3) III; tjIs54 [Ppie-1GFP::TBB-2 + Ppie-1 2xmCherry::TBG-1 + unc-119(+)]; tjIs57 [Ppie-1 mCherry::HIS-48 + unc-119(+)]"|"tjIs54 [pie-1p::GFP::tbb-2 + pie-1p::2xmCherry::tbg-1 + unc-119(+)]. tjIs57 [pie-1p::mCherry::his-48 + unc-119(+)]. Maintain at 25C to avoid transgene silencing. Reference: Toya M, et al. Methods Cell Biol. 2010;97:359-72."|"WBStrain provided so WBPaper00061495 paper added based on AFP_Strain data." | WB-STRAIN:WBStrain00033888 | WormBase (WB) | WB | available | PMID:31645459 PMID:37684042 PMID:37995185 PMID:38034351 |
WB-STRAIN:SA250, CGC_SA250 | 2026-08-15 09:32:25 | 5 | ||||
|
SAL144 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033897 | Caenorhabditis elegans | pha-1(e2123) III; denEx22. | denEx22 [K08D8.5::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00033897 | WormBase (WB) | WB | available | WB-STRAIN:SAL144, CGC_SAL144 | 2026-08-15 09:32:25 | 1 | |||
|
SAL146 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033898 | Caenorhabditis elegans | pha-1(e2123) III; denEx24. | denEx24 [clec-85p::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00033898 | WormBase (WB) | WB | available | WB-STRAIN:SAL146, CGC_SAL146 | 2026-08-15 09:32:26 | 1 | |||
|
SAL148 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033899 | Caenorhabditis elegans | pha-1(e2123) III; denEx26. | denEx26 [F08G5.6::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53. | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00033899 | WormBase (WB) | WB | available | WB-STRAIN:SAL148, CGC_SAL148 | 2026-08-15 09:32:26 | 1 | |||
|
RZB217 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033876 | Caenorhabditis elegans | plst-1(msn190[plst-1::gfp]) IV; zbIs2(pie-1::lifeACT::RFP). | EMPTY | WBGene00022425(plst-1) | WBGene00022425(plst-1) | WB-STRAIN:WBStrain00033876 | WormBase (WB) | WB | unknown | PMID:28400443 | WB-STRAIN:RZB217 | 2026-08-15 09:32:25 | 3 | ||
|
SD1347 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033941 | Caenorhabditis elegans | ccIs4251 I; stIs10079. | ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10079 [unc-54p::his-24::mCherry::let-858 3' UTR + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).|"Growth temperature 20 degC" | WB-STRAIN:WBStrain00033941 | WormBase (WB) | WB | available | PMID:15605074 | WB-STRAIN:SD1347, CGC_SD1347 | 2026-08-15 09:32:27 | 2 | ||||
|
SCL1 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033903 | Caenorhabditis elegans | mcp-1(tm2679) V. | EMPTY | WBGene00015678(mcp-1) | WBGene00015678(mcp-1) | WB-STRAIN:WBStrain00033903 | WormBase (WB) | WB | available | WB-STRAIN:SCL1, CGC_SCL1 | 2026-08-15 09:32:26 | 1 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
