Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
bli-2(e1027) II Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051520 | Caenorhabditis elegans | bli-2(e1027) II | Supplementary_genotype bli-2(e1027) II | WB-STRAIN:WBStrain00051520 | WormBase (WB) | WB | unknown | PMID:37980413 | 2026-08-29 09:27:39 | 1 | |||||
|
bli-1(e944) II Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051515 | Caenorhabditis elegans | bli-1(e944) II | Supplementary_genotype bli-1(e944) II | WB-STRAIN:WBStrain00051515 | WormBase (WB) | WB | unknown | PMID:37980413 | 2026-08-29 09:27:39 | 1 | |||||
|
bli-2(e772) II Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051514 | Caenorhabditis elegans | bli-2(e772) II | Supplementary_genotype bli-2(e772) II | WB-STRAIN:WBStrain00051514 | WormBase (WB) | WB | unknown | PMID:37980413 | 2026-08-29 09:27:39 | 1 | |||||
|
bli-1(e1610) II Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051518 | Caenorhabditis elegans | bli-1(e1610) II | Supplementary_genotype bli-1(e1610) II | WB-STRAIN:WBStrain00051518 | WormBase (WB) | WB | unknown | PMID:37980413 | 2026-08-29 09:27:39 | 1 | |||||
|
bli-1(e1431) II Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051517 | Caenorhabditis elegans | bli-1(e1431) II | Supplementary_genotype bli-1(e1431) II | WB-STRAIN:WBStrain00051517 | WormBase (WB) | WB | unknown | PMID:37980413 | 2026-08-29 09:27:39 | 1 | |||||
|
bli-1(e976) II Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051516 | Caenorhabditis elegans | bli-1(e976) II | Supplementary_genotype bli-1(e976) II | WB-STRAIN:WBStrain00051516 | WormBase (WB) | WB | unknown | PMID:37980413 | 2026-08-29 09:27:39 | 1 | |||||
|
enIs74 II; unc-76(e911) V. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051503 | Caenorhabditis elegans | enIs74 II; unc-76(e911) V. | enIs74 [mec-7p::GFP + dyn-1p::mfg-e8::mCherry + unc-76(+)] II. mec-7p::GFP labels touch neurons. MFG-E8::mCherry reporter binds exposed phosphatidylserine (PS) eat me signal on the surface of apoptotic or necrotic cells, providing a useful marker for identifying apoptotic or necrotic cells. Reference: Furuta Y, et al. PLoS Genet. 2021 Feb 11;17(2):e1009066.|"Made_by: Henry He" | WBGene00006808(unc-76) | WBGene00006808(unc-76) | WB-STRAIN:WBStrain00051503 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:38 | 2 | ||||
|
unc-119(ox819 oxTi1126) III. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051652 | Caenorhabditis elegans | unc-119(ox819 oxTi1126) III. | oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https: | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051652 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:41 | 1 | ||||
|
osIs158 II. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051713 | Caenorhabditis elegans | osIs158 II. | Made_by: Takefumi Negishi|"osIs158 [eft-3p::AtTIR1(F79G)::mRuby] II. Single copy insertion into ttTi5605 on LG II. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218." | WB-STRAIN:WBStrain00051713 | WormBase (WB) | WB | unknown | PMID:34865044 | 2026-08-29 09:27:42 | 1 | |||||
|
qIs56 him-5(e1490) V; qEx557. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051719 | Caenorhabditis elegans | qIs56 him-5(e1490) V; qEx557. | qIs56 [lag-2p::GFP + unc-119(+)] V. qEx557 [hsp-16p::ceh-22b + ttx-3::DsRed]. Him. Pick DsRed+ animals to maintain qEx557 array. Heat-shock can be used to drive the ectopic expression of CEH-22B (derived from Fire Lab vector pPD49.78). LAG-2::GFP is expressed the embryo, nerve cord, Z1/Z4, and DTCs. Reference: Lam N. et al. Curr Biol. 2006 Feb 7;16(3):287-95. doi: 10.1016/j.cub.2005.12.015. PMID: 16461282 | WBGene00001864(him-5) | WBGene00001864(him-5) | WB-STRAIN:WBStrain00051719 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:42 | 1 | ||||
|
mod-5(vlc47[mod-5::T2A::mNeonGreen]) I. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051808 | Caenorhabditis elegans | mod-5(vlc47[mod-5::T2A::mNeonGreen]) I. | Made_by: Carlos Mora-Martnez|"mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334" | WBGene00003387(mod-5) | WBGene00003387(mod-5) | WB-STRAIN:WBStrain00051808 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:44 | 2 | ||||
|
ins-9(syb2616[ins-9::T2A::3xNLS::GFP]) X. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051847 | Caenorhabditis elegans | ins-9(syb2616[ins-9::T2A::3xNLS::GFP]) X. | Endogenous ins-9 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.|"Supplementary_genotype ins-9(syb2616[ins-9::T2A::3xNLS::GFP]) X" | WBGene00002092(ins-9) | WBGene00002092(ins-9) | WB-STRAIN:WBStrain00051847 | WormBase (WB) | WB | unknown | PMID:37935195 | 2026-08-29 09:27:44 | 1 | |||
|
unc-116(gk5722udn86)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00052059 | Caenorhabditis elegans | unc-116(gk5722udn86)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. | Made_by: UDN Screening Center|"nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complemement all markers on qC1. Pick wild-type GFP+ to maintain. Heterozygotes are slightly dumpy GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP udn45 homozygotes (larval arrest; very few escapers grow into Dumpy Unc adults). Variant edit allele T90I. TspRI restriction site created by synonymous changes for ease of genotyping. Derived from VC4653; selection cassette in VC4653 was removed, and then crossed with qC1 nIs189 [myo-2::GFP] banlancer."|"nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), and non-GFP gk5722udn86 homozygotes (larval arrest; few escapers). Derived from VC4653; selection cassette in VC4653 was removed, and then crossed with qC1 nIs189 [myo-2::GFP] balancer."|"Null deletion."|"Supplementary_genotype unc-116(gk5722udn86)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III" | WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00006840(unc-116) | WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00006840(unc-116) | WB-STRAIN:WBStrain00052059 | WormBase (WB) | WB | unknown | PMID:37934770 | 2026-08-29 09:27:48 | 1 | |||
|
-nc1Tg Resource Report Resource Website 1+ mentions |
RRID:ZIRC_ZL10089 | Danio rerio | Transgenic Insertion | -nc1Tg | nc1Tg | ZL10089 | Zebrafish Lines at ZIRC | ZIRC | frozen | 2026-08-29 10:44:23 | 1 | |||||
|
-pd41Tg Resource Report Resource Website 1+ mentions |
RRID:ZIRC_ZL9916 | Danio rerio | Transgenic Insertion | -pd41Tg | pd41Tg | ZL9916 | Zebrafish Lines at ZIRC | ZIRC | frozen | 2026-08-29 10:44:24 | 1 | |||||
|
-pd42Tg Resource Report Resource Website 1+ mentions |
RRID:ZIRC_ZL9917 | Danio rerio | Transgenic Insertion | -pd42Tg | pd42Tg | ZL9917 | Zebrafish Lines at ZIRC | ZIRC | frozen | 2026-08-29 10:44:24 | 1 | |||||
|
-pd45Tg Resource Report Resource Website 1+ mentions |
RRID:ZIRC_ZL9918 | Danio rerio | Transgenic Insertion | -pd45Tg | pd45Tg | ZL9918 | Zebrafish Lines at ZIRC | ZIRC | frozen | 2026-08-29 10:44:24 | 2 | |||||
|
nl1Tg/+ (AB) Resource Report Resource Website 1+ mentions |
RRID:ZIRC_ZL1747 | Danio rerio | Transgenic Insertion | nl1Tg/+ (AB) | nl1Tg | ZL1747 | AB | Zebrafish Lines at ZIRC | ZIRC | frozen | 2026-08-29 10:44:23 | 6 | ||||
|
-pd10Tg (AB) Resource Report Resource Website 1+ mentions |
RRID:ZIRC_ZL14378 | Danio rerio | Transgenic Insertion | -pd10Tg (AB) | pd10Tg | ZL14378 | AB | Zebrafish Lines at ZIRC | ZIRC | frozen | 2026-08-29 10:44:23 | 1 | ||||
|
rk8Tg/+ (AB) Resource Report Resource Website 1+ mentions |
RRID:ZIRC_ZL1088 | Danio rerio | Transgenic Insertion | rk8Tg/+ (AB) | rk8Tg | ZL1088 | AB | Zebrafish Lines at ZIRC | ZIRC | frozen | 2026-08-29 10:44:24 | 1 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
