Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/60304
Proper Citation: RRID:Addgene_60304
Insert Name: ZMIZ1 enhancer
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:24413736
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Comments: chromosome : chr10; start: 80613972 end: 80614474 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCCTCTGTCTTCCTTCCACCA Rv primer used for cloning: CACGGCTCCATTGGCATCTCC
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pGL4.23 C3_22.
No alerts have been found for pGL4.23 C3_22.
Source: Addgene