Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/43805
Proper Citation: RRID:Addgene_43805
Insert Name: Hes1 Promoter (-467 to +46) RBPj(-)
Organism: Mus musculus
Bacterial Resistance: Ampicillin
Defining Citation: PMID:9570950
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Comments: Alternate plasmid name: Hes1/RBP-J (-) This construct contains the murine Hes1 promoter lacking the RBP-J site. Relevant sequence portion: WT: -86 /TGTGGGAAAGAAAGTTTGGGAAGTTT/ -61 Rbp J(-): -86 /TGTG[CTGC]AGAAAgtTT[CTCG]AGTTT/ -61 (mutated sequences are bracketed) In Rbp J(-), PstI (CTGCAG) and XhoI (CTCGAG) sites are introduced. Addgene quality control discovered a 2-base deletion (lower case letters) in the murine Hes1 promoter. This should not affect the function, and the vector is OK.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pHes1(467 RBPj(-))-luc.
No alerts have been found for pHes1(467 RBPj(-))-luc.
Source: Addgene
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
