Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/239459
Proper Citation: RRID:Addgene_239459
Bacterial Resistance: Spectinomycin and Streptomycin
Defining Citation: PMID:40864707
Vector Backbone Description: Vector Backbone:pMCY2; Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Comments: Two cloning steps are required for the generation of a "promoter:3xHA:VENUS:GENE:2A:mTurqN7" fragment: A) Cloning of promoter: Primer design: Forward Primer: 5’GATCGGGGCGCGCCCTCGAG+PROMOTER SPECIFIC SEQUENCE 3’ Reverse primer: 5’ GATGGGCATTAACATCTTTTAC+PROMOTER SPECIFIC SEQUENCE 3' Digest plasmid with SapI Clean Perform Gibson Assembly Transform E. coli and select positive colonies LB+Sp/Sm (blue/white selection) B) Cloning of gene fragment: Forward Primer: 5’GTTCTGGTGGGGGTGGCTCC+ GENE SPECIFIC SEQUENCE (starting from the ATG) 3’ Reverse primer: 5’ AACAGCTGGCCCGAGCCACC+GENE SPECIFIC SEQUENCE (without STOP Codon) 3' Digest plasmid with Bsu36I and perform gel purification Perform Gibson Assembly Transform E. coli and select positive colonies LB+Sp/Sm The discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pMDS2.
No alerts have been found for pMDS2.
Source: Addgene
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
