Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/30121
Proper Citation: RRID:Addgene_30121
Bacterial Resistance: Ampicillin
Vector Backbone Description: Backbone Size:5279; Vector Backbone:pFastBac Dual; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is a LIC-adapted pFastBac Dual vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector is a dual expression vector, and your 2 genes can be inserted in any order (check your gene for internal restriction sites, as this may dictate cloning order). LIC site v1: Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize vector with SspI and gel purify. T4-treat vector with dGTP. For the PCR product, T4-treat with dCTP. LIC site v2 LicV2 Forward Tag TTTAAGAAGGAGATATAGATC(ATG) LicV2 Reverse Tag TTATGGAGTTGGGATCTTATTA Linearize vector with EcoRV and gel purify. T4-treat vector with dCTP. For the PCR product, T4-treat with dGTP. To sequence LIC site v1, use the following primers: LicBac dual V1 F cctataactattccggattattcataccgtc LicBac dual V1 R caggttcagggggaggtgtg To sequence LIC site v2, use the following primers: LicBac dual V2 F gtcatagcgcgggttccttcc LicBac dual V2 R ggagtatacggacctttaattcaaccc For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pFastBac Dual LIC cloning vector (5A).
No alerts have been found for pFastBac Dual LIC cloning vector (5A).
Source: Addgene (RRID:SCR_002037)
Description: Non-profit plasmid repository dedicated to helping scientists around the world share high-quality plasmids. Facilitates archiving and distributing DNA-based research reagents and associated data to scientists worldwide. Repository contains over 65,000 plasmids, including special collections on CRISPR, fluorescent proteins, and ready-to-use viral preparations. There is no cost for scientists to deposit plasmids, which saves time and money associated with shipping plasmids themselves. All plasmids are fully sequenced for validation and sequencing data is openly available. We handle the appropriate Material Transfer Agreements (MTA) with institutions, facilitating open exchange and offering intellectual property and liability protection for depositing scientists. Furthermore, we curate free educational resources for the scientific community including a blog, eBooks, video protocols, and detailed molecular biology resources.
URL: http://www.addgene.org
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
