Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Plasmid Name
(E6) CMV-p18 C/EBPalpha
RRID:Addgene_25881 RRID Copied  
PDF Report How to cite
RRID:Addgene_25881
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/25881

Proper Citation: RRID:Addgene_25881

Insert Name: p18 C/EBPalpha

Organism: Mus musculus

Bacterial Resistance: Ampicillin

Defining Citation: PMID:11340085

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Comments: To create a non-His-tagged form of CR4, His-p18C/EBPα was linearized with HindIII, and a fill-in reaction was performed to blunt end the vector. The linearized vector was then digested with BglII, and the resulting fragment was subcloned into the BamHI-EcoRV site of pcDNA3.1(+) (Invitrogen) containing an ideal Kozak consensus sequence oligonucleotide (AGCTTGCGGCCGCCACCATGGG) 5′ to theBamHI site. p18 refers to the fact that this is an N-terminally truncated His fusion corresponding to roughly 18kDa.

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for (E6) CMV-p18 C/EBPalpha.

No alerts have been found for (E6) CMV-p18 C/EBPalpha.

Data and Source Information

Source: Addgene