Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/25881
Proper Citation: RRID:Addgene_25881
Insert Name: p18 C/EBPalpha
Organism: Mus musculus
Bacterial Resistance: Ampicillin
Defining Citation: PMID:11340085
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: To create a non-His-tagged form of CR4, His-p18C/EBPα was linearized with HindIII, and a fill-in reaction was performed to blunt end the vector. The linearized vector was then digested with BglII, and the resulting fragment was subcloned into the BamHI-EcoRV site of pcDNA3.1(+) (Invitrogen) containing an ideal Kozak consensus sequence oligonucleotide (AGCTTGCGGCCGCCACCATGGG) 5′ to theBamHI site. p18 refers to the fact that this is an N-terminally truncated His fusion corresponding to roughly 18kDa.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for (E6) CMV-p18 C/EBPalpha.
No alerts have been found for (E6) CMV-p18 C/EBPalpha.
Source: Addgene
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
