Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Resource Summary Report New Search Previous Search Results

Plasmid Name

E. coli BW25113:PcpcG2-tetR (CMB247)

RRID:Addgene_254898 RRID Copied

PDF Report How to cite

RRID:Addgene_254898

Copy Citation Copied

Plasmid Information

URL: http://www.addgene.org/254898

Proper Citation: RRID:Addgene_254898

Insert Name: Carries a single chromosomal copy of the repressor TetR downstream of PcpcG2 promoter inserted in nupG locus

Bacterial Resistance: None

Defining Citation: PMID:41996246

Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None

Comments: For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion. Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint.

Expand All

Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

View full usage report

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

Report Information

No rating or validation information has been found for E. coli BW25113:PcpcG2-tetR (CMB247).

No alerts have been found for E. coli BW25113:PcpcG2-tetR (CMB247).

Data and Source Information

Source: Addgene (RRID:SCR_002037)
Description: Non-profit plasmid repository dedicated to helping scientists around the world share high-quality plasmids. Facilitates archiving and distributing DNA-based research reagents and associated data to scientists worldwide. Repository contains over 65,000 plasmids, including special collections on CRISPR, fluorescent proteins, and ready-to-use viral preparations. There is no cost for scientists to deposit plasmids, which saves time and money associated with shipping plasmids themselves. All plasmids are fully sequenced for validation and sequencing data is openly available. We handle the appropriate Material Transfer Agreements (MTA) with institutions, facilitating open exchange and offering intellectual property and liability protection for depositing scientists. Furthermore, we curate free educational resources for the scientific community including a blog, eBooks, video protocols, and detailed molecular biology resources.
URL: http://www.addgene.org

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.