Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/239460
Proper Citation: RRID:Addgene_239460
Bacterial Resistance: Spectinomycin and Streptomycin
Defining Citation: PMID:40864707
Vector Backbone Description: Vector Backbone:pMCY2; Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Comments: For cloning a promoter + gene fragment (without stop codon) via Gibson Assembly, we recommend the following approach: Primer design: Forward primer: 5’GATCGGGGCGCGCCCTCGAG+PROMOTER SPECIFIC PRIMER 3’ Reverse primer: 5’ CAGAACCACCACCTCCGGATCC+GENE SPECIFIC PRIMER W/O STOP CODON 3' Digest pMDS1 plasmid with SAP I enzyme Clean up Perform Gibson assembly reaction Transform E. coli (DH5alpha) Select on LB + Sp + Sm
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pMDS1.
No alerts have been found for pMDS1.
Source: Addgene
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
