Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/21618
Proper Citation: RRID:Addgene_21618
Insert Name: Oct3 shRNA
Bacterial Resistance: Ampicillin
Defining Citation: PMID:18719224
Vector Backbone Description: Backbone Size:7861; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: Oct3 shRNA sequence is - 5'-TTGTTTGAACCGTGTGAGGTGGAACTTCAAGAGAGTTCCACCTCACACGGTTCT This is a 3rd generation lentiviral plasmid. This plasmid worked for mouse and rat Oct4 knockdown, but it was not tested in human cells.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pLLNeo-Oct3.
No alerts have been found for pLLNeo-Oct3.
Source: Addgene