Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/209754
Proper Citation: RRID:Addgene_209754
Insert Name: MS4A1
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:37683180
Vector Backbone Description: Backbone Size:7456; Vector Backbone:pCDH-IRES-BSD; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Comments: Lentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 3 mRNA isoform of CD20. The "CCTGGGGGGTCTTCTGATGATCC" sequence within the CDS of MS4A1 was altered with synonymous substitutions to "GTTGGGCGGACTACTTATGATTC" to avoid recognition by the gRNA from LentiCRISPRv2-sgCD20. This allows for the rescue of CD20 expression after LentiCRISPRv2-sgCD20 vector-mediated knockout.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pCDH-V3-rCD20-BSD.
No alerts have been found for pCDH-V3-rCD20-BSD.
Source: Addgene
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
