Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Plasmid Name
BL21 Rosetta2 ΔrecBCD GamS
RRID:Addgene_176586 RRID Copied  
PDF Report How to cite
RRID:Addgene_176586
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/176586

Proper Citation: RRID:Addgene_176586

Insert Name: pRARE2 + pBADmod1-linker2-gamS plasmid

Bacterial Resistance: Chloramphenicol and Ampicillin

Defining Citation: PMID:35034449

Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin

Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for BL21 Rosetta2 ΔrecBCD GamS.

No alerts have been found for BL21 Rosetta2 ΔrecBCD GamS.

Data and Source Information

Source: Addgene