Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Tertem3Mcwi Resource Report The record is no longer available at this source. |
RRID:RGD_13207522 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Tert gene of Crl:SD rat embryos. The resulting mutation is a 17-bp deletion of exon1 in Tert gene. MCW Gene Editing Rat Resource Center This is a legacy resource. | (null) | (null) | (null) | 13207522 | mutant | RGD, Rat Genome Database Strain List RGD | RGD | Not Available | 2024-01-31 07:40:17 | 0 | |||
|
F344-Fmr1em1Rrrc Resource Report The record is no longer available at this source. |
RRID:RGD_11537344 | Rattus norvegicus | The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. It inserted 55-79 copies of human premutation CGG repeats of the FMR1 gene into rat Fmr1. The recipient zygotes were from inbred strain F344 at RRRC. Rat Resource and Research Center This is a legacy resource. | (null) | (null) | (null) | 11537344 | mutant | RGD, Rat Genome Database Strain List RGD | RGD | Not Available | 2024-01-31 07:40:17 | 0 | |||
|
SS-Avpr2em3Mcwi Resource Report The record is no longer available at this source. |
RRID:RGD_13208586 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 2 of the Avpr2 gene. MCW Gene Editing Rat Resource Center This is a legacy resource. | (null) | (null) | (null) | 13208586 | mutant | RGD, Rat Genome Database Strain List RGD | RGD | Not Available | 2024-01-31 07:40:18 | 0 | |||
|
SS-Avpr2em2Mcwi Resource Report The record is no longer available at this source. |
RRID:RGD_13208585 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in Exon 2 of the Avpr2 gene. MCW Gene Editing Rat Resource Center This is a legacy resource. | (null) | (null) | (null) | 13208585 | mutant | RGD, Rat Genome Database Strain List RGD | RGD | Not Available | 2024-01-31 07:40:18 | 0 | |||
|
SD-Prl7b1tm1(cre)Soar Resource Report Resource Website |
001013 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site. Rat Resource and Research Center | 001013 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-11-21) | RGD_401900746 | 2025-08-16 03:25:59 | 0 | |||||
|
LE-Synpoem2Kmh Resource Report Resource Website |
001025 | Rattus norvegicus | Exons 2 and 3 were deleted to eliminate all known Synaptopodin isoforms in the outbred Long Evans (Charles River 006). It is similar to RRRC strain #964 (LE-Synpoem1Kmh) (RGD:155782907), has a different mutation location upstream of exon 2. This strain is deposited at Rat Resource and Research Center | 001025 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryopreserved Sperm (as of 2025-05-13) | RGD_616335891 | 2025-08-16 03:26:02 | 0 | |||||
|
LE-Pink1em1Davis Resource Report Resource Website |
001007 | Rattus norvegicus | The CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos. The rat is deposited at Rat Resource and Research Center (RRRC). Rat Resource and Research Center | 001007 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryorecovery (as of 2025-01-27) | RGD_401827145 | 2025-08-16 03:26:02 | 0 | |||||
|
BRAT-Avpdi/BluHsd Resource Report Resource Website |
RRID:RGD_2314655 | Rattus norvegicus | Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. Harlan | 2314655 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21) | 2314655 | 2026-07-25 12:42:50 | 0 | |||||
|
F344-Hrkrh/Kyo Resource Report Resource Website |
RRID:RGD_2314230 | Rattus norvegicus | , Hanako | A mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan | 2314230 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 2314230 | 2026-07-25 12:42:49 | 0 | ||||
|
KFRS2/Kyo Resource Report Resource Website |
RRID:RGD_2314365 | Rattus norvegicus | A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. National BioResource Project for the Rat in Japan | 2314365 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 2314365 | 2026-07-25 12:42:49 | 0 | |||||
|
SS-Renem1Mcwi Resource Report Resource Website |
RRID:RGD_4139880 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. | 4139880 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2017-01-26) | 4139880 | 2026-07-25 12:42:50 | 0 | |||||
|
SS-Nox4em2Mcwi Resource Report Resource Website |
RRID:RGD_4139883 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7. | 4139883 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2017-01-26) | 4139883 | 2026-07-25 12:42:50 | 0 | |||||
|
SS-Sh2b3em1Mcwi Resource Report Resource Website |
RRID:RGD_4139885 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2. | 4139885 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 4139885 | 2026-07-25 12:42:50 | 0 | |||||
|
SD-Pax6Sey/Mce Resource Report Resource Website |
RRID:RGD_2325754 | Rattus norvegicus | Autosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA. | 2325754 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 2325754 | 2026-07-25 12:42:51 | 0 | |||||
|
AMI/Tj Resource Report Resource Website |
RRID:RGD_4142546 | Rattus norvegicus | Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003. National BioResource Project for the Rat in Japan | 4142546 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo | 4142546 | 2026-07-25 12:42:50 | 0 | |||||
|
SS-Apoeem8Mcwi Resource Report Resource Website |
RRID:RGD_5131920 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 2. | 5131920 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5131920 | 2026-07-25 12:42:51 | 0 | |||||
|
SS-Apoeem7Mcwi Resource Report Resource Website |
RRID:RGD_5131921 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2. | 5131921 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5131921 | 2026-07-25 12:42:51 | 0 | |||||
|
SS-Agtrapem4Mcwi Resource Report Resource Website |
RRID:RGD_5143989 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp mutation deleting part of exon 3 and the splice acceptor. | 5143989 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5143989 | 2026-07-25 12:42:52 | 0 | |||||
|
SS-Plekha7em1Mcwi Resource Report Resource Website |
RRID:RGD_5143984 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6. | 5143984 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5143984 | 2026-07-25 12:42:52 | 0 | |||||
|
SS-Gpr183em3Mcwi Resource Report Resource Website |
RRID:RGD_5143987 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2. | 5143987 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 5143987 | 2026-07-25 12:42:52 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.