Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Background:mutant (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,464 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
SD-Tertem3Mcwi
 
Resource Report

The record is no longer available at this source.
RRID:RGD_13207522 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Tert gene of Crl:SD rat embryos. The resulting mutation is a 17-bp deletion of exon1 in Tert gene. MCW Gene Editing Rat Resource Center This is a legacy resource. (null) (null) (null) 13207522 mutant RGD, Rat Genome Database Strain List RGD RGD Not Available 2024-01-31 07:40:17 0
F344-Fmr1em1Rrrc
 
Resource Report

The record is no longer available at this source.
RRID:RGD_11537344 Rattus norvegicus The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. It inserted 55-79 copies of human premutation CGG repeats of the FMR1 gene into rat Fmr1. The recipient zygotes were from inbred strain F344 at RRRC. Rat Resource and Research Center This is a legacy resource. (null) (null) (null) 11537344 mutant RGD, Rat Genome Database Strain List RGD RGD Not Available 2024-01-31 07:40:17 0
SS-Avpr2em3Mcwi
 
Resource Report

The record is no longer available at this source.
RRID:RGD_13208586 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 2 of the Avpr2 gene. MCW Gene Editing Rat Resource Center This is a legacy resource. (null) (null) (null) 13208586 mutant RGD, Rat Genome Database Strain List RGD RGD Not Available 2024-01-31 07:40:18 0
SS-Avpr2em2Mcwi
 
Resource Report

The record is no longer available at this source.
RRID:RGD_13208585 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in Exon 2 of the Avpr2 gene. MCW Gene Editing Rat Resource Center This is a legacy resource. (null) (null) (null) 13208585 mutant RGD, Rat Genome Database Strain List RGD RGD Not Available 2024-01-31 07:40:18 0
SD-Prl7b1tm1(cre)Soar
 
Resource Report
Resource Website
001013 Rattus norvegicus CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site. Rat Resource and Research Center 001013 mutant Rat Resource and Research Center (RRRC) RRRC Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-11-21) RGD_401900746 2025-08-16 03:25:59 0
LE-Synpoem2Kmh
 
Resource Report
Resource Website
001025 Rattus norvegicus Exons 2 and 3 were deleted to eliminate all known Synaptopodin isoforms in the outbred Long Evans (Charles River 006). It is similar to RRRC strain #964 (LE-Synpoem1Kmh) (RGD:155782907), has a different mutation location upstream of exon 2. This strain is deposited at Rat Resource and Research Center 001025 mutant Rat Resource and Research Center (RRRC) RRRC Cryopreserved Sperm (as of 2025-05-13) RGD_616335891 2025-08-16 03:26:02 0
LE-Pink1em1Davis
 
Resource Report
Resource Website
001007 Rattus norvegicus The CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos. The rat is deposited at Rat Resource and Research Center (RRRC). Rat Resource and Research Center 001007 mutant Rat Resource and Research Center (RRRC) RRRC Cryorecovery (as of 2025-01-27) RGD_401827145 2025-08-16 03:26:02 0
BRAT-Avpdi/BluHsd
 
Resource Report
Resource Website
RRID:RGD_2314655 Rattus norvegicus Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. Harlan 2314655 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21) 2314655 2026-07-25 12:42:50 0
F344-Hrkrh/Kyo
 
Resource Report
Resource Website
RRID:RGD_2314230 Rattus norvegicus , Hanako A mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan 2314230 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm 2314230 2026-07-25 12:42:49 0
KFRS2/Kyo
 
Resource Report
Resource Website
RRID:RGD_2314365 Rattus norvegicus A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. National BioResource Project for the Rat in Japan 2314365 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm 2314365 2026-07-25 12:42:49 0
SS-Renem1Mcwi
 
Resource Report
Resource Website
RRID:RGD_4139880 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. 4139880 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm (as of 2017-01-26) 4139880 2026-07-25 12:42:50 0
SS-Nox4em2Mcwi
 
Resource Report
Resource Website
RRID:RGD_4139883 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7. 4139883 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm (as of 2017-01-26) 4139883 2026-07-25 12:42:50 0
SS-Sh2b3em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_4139885 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2. 4139885 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 4139885 2026-07-25 12:42:50 0
SD-Pax6Sey/Mce
 
Resource Report
Resource Website
RRID:RGD_2325754 Rattus norvegicus Autosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA. 2325754 mutant Rat Genome Database (RGD) RGD Unknown 2325754 2026-07-25 12:42:51 0
AMI/Tj
 
Resource Report
Resource Website
RRID:RGD_4142546 Rattus norvegicus Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003. National BioResource Project for the Rat in Japan 4142546 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo 4142546 2026-07-25 12:42:50 0
SS-Apoeem8Mcwi
 
Resource Report
Resource Website
RRID:RGD_5131920 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 2. 5131920 mutant Rat Genome Database (RGD) RGD Extinct 5131920 2026-07-25 12:42:51 0
SS-Apoeem7Mcwi
 
Resource Report
Resource Website
RRID:RGD_5131921 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2. 5131921 mutant Rat Genome Database (RGD) RGD Extinct 5131921 2026-07-25 12:42:51 0
SS-Agtrapem4Mcwi
 
Resource Report
Resource Website
RRID:RGD_5143989 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp mutation deleting part of exon 3 and the splice acceptor. 5143989 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 5143989 2026-07-25 12:42:52 0
SS-Plekha7em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_5143984 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6. 5143984 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 5143984 2026-07-25 12:42:52 0
SS-Gpr183em3Mcwi
 
Resource Report
Resource Website
RRID:RGD_5143987 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2. 5143987 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 5143987 2026-07-25 12:42:52 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.