Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 79 results
Snippet view Table view Download 79 Result(s)
Click the to add this resource to a Collection
  • RRID:RGD_4139885

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139885

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 4139885
Notes: This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.

Proper citation: RRID:RGD_4139885 Copy   


  • RRID:RGD_5131910

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131910

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 5131910
Notes: This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_5131910 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688087

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 5688087
Notes: ZFN mutant founders were backcrossed with FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5688087 Copy   


  • RRID:RGD_5685369

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5685369

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 5685369
Notes: This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp frameshift deletion in exon 3.

Proper citation: RRID:RGD_5685369 Copy   


  • RRID:RGD_6484573

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484573

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 6484573
Notes: This strain was produced by injecting ZFNs targeting the sequence GTCCCTGGTGACGACtgtggtGGTGTTTGTGGCCTCCATG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 13.

Proper citation: RRID:RGD_6484573 Copy   


  • RRID:RGD_5686318

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686318

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 5686318
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation is an in-frame 6-bp deletion in exon 2 .

Proper citation: RRID:RGD_5686318 Copy   


  • RRID:RGD_10002794

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10002794

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 10002794
Notes: This strain was produced by injecting TALENs targeting the sequence CTTAGACAACTCTCAATAGCTttatgggcctcggccAAGCGGCATGGAAGGAGGC into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_10002794 Copy   


  • RRID:RGD_11553899

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553899

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 11553899
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Trpv2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553899 Copy   


  • RRID:RGD_11553855

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553855

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 11553855
Notes: CRISPR/Cas9 system was used to introduce a 7-bp deletion mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553855 Copy   


  • RRID:RGD_11553852

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553852

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 11553852
Notes: CRISPR/Cas9 system and ssODN was used to introduce a N131S mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553852 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12437069

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12437069
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Btg2 gene of SS.BN-(D13Rat25-rs198199323)/Mcwi rat embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_12437069 Copy   


  • RRID:RGD_12790608

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790608

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12790608
Notes: The CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of the Cd14 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_12790608 Copy   


  • RRID:RGD_11553912

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553912

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 11553912
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp insertion in Exon 2 of the Trpc6 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553912 Copy   


  • RRID:RGD_12790698

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790698

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12790698
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 5 in the Pon1 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_12790698 Copy   


  • RRID:RGD_12790629

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790629

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12790629
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Igh-6 gene of LEW/Ncrl rat embryos. The resulting mutation is a 2-bp deletion in the exon 2 of the Igh-6 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_12790629 Copy   


  • RRID:RGD_12790710

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790710

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12790710
Notes: This strain was produced by injecting TALENs targeting the sequence into Crl:SD rat embryos. The resulting mutation is a 10-bp deletion in exon 2.

Proper citation: RRID:RGD_12790710 Copy   


  • RRID:RGD_12790679

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790679

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12790679
Notes: CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of PCK/CrljCrl-Pkhd1pck/Crl rat embryos. The resulting mutation is a 1-bp insertion in Exon 2 of the P2rx7 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_12790679 Copy   


  • RRID:RGD_12790662

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790662

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12790662
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Mb gene of WKY/NCrl rat embryos. The resulting mutation is a 25-bp deletion in the exon 2 of the Mb gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_12790662 Copy   


  • RRID:RGD_12790944

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790944

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12790944
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 5-bp deletion in exon 4 of the Sik2 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_12790944 Copy   


  • RRID:RGD_11553908

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553908

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 11553908
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp substitutions to generate P112Q in Exon 2 of the Trpc6 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553908 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X