Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://zfin.org/ZDB-GENO-960809-7
Source Database: ZFIN, Zebrafish Information Network (ZFIN)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms:
Alternate IDs:
Notes: This is a legacy resource.
Proper citation: RRID:ZFIN_ZDB-GENO-960809-7 Copy
https://zfin.org/ZDB-GENO-030619-2
Source Database: ZFIN, Zebrafish Information Network (ZFIN)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms:
Alternate IDs:
Notes: "wild type (unspecified)" is displayed in ZFIN gene expression and phenotype data records if a publication did not specify which wild-type line was used in an experiment. This is a legacy resource.
Proper citation: RRID:ZFIN_ZDB-GENO-030619-2 Copy
http://www.wormbase.org/db/get?name=WBStrain00055339
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: syIs815; syIs337.
Alternate IDs:
Notes: Made_by: Mark Zhang/Stephanie Nava|"syIs815 [nlp-76p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector."
Proper citation: RRID:WB-STRAIN:WBStrain00055339 Copy
http://www.wormbase.org/db/get?name=WBStrain00055399
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00018011(F33E11.3)
Genomic Alteration: WBGene00018011(F33E11.3)
Availability: unknown
References:
Synonyms: F33E11.3(sy2024) V.
Alternate IDs:
Notes: Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F33E11.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATGTTCGATATCAGCGATTGGCTCAGGAGTATA. Right flanking sequence: CGAAGgtgcggacgagaaaattttttttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTGGCTCAGGAGTATACGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616."
Proper citation: RRID:WB-STRAIN:WBStrain00055399 Copy
http://www.wormbase.org/db/get?name=WBStrain00055398
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00009064(F22G12.4)
Genomic Alteration: WBGene00009064(F22G12.4)
Availability: unknown
References:
Synonyms: F22G12.4(sy2022) I.
Alternate IDs:
Notes: Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F22G12.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: caccaaaacccaaccaatttccagAGAACCTTTCGG. Right flanking sequence: CAATGGATTTCCTGCTCGGCAACGGAGCCGATGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCCAGAGAACCTTTCGGCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616."
Proper citation: RRID:WB-STRAIN:WBStrain00055398 Copy
http://www.wormbase.org/db/get?name=WBStrain00055431
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: +/nT1[umnIs49] IV; Y61A9LA.10(ve782[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V.
Alternate IDs:
Notes: Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 8730 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve782 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctTCAGGAGCTGCTCGCCGATGAGCCAAGA ; Right flanking sequence: cacggcgtgcgcgtcagtgtcacgaaacgc. sgRNA #1: GCAAAACTTCGAAAGGCTCT; sgRNA #2: aaattggttgctgacgcgca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00055431 Copy
http://www.wormbase.org/db/get?name=WBStrain00055397
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00009027(htt-1)
Genomic Alteration: WBGene00009027(htt-1)
Availability: unknown
References:
Synonyms: F21G4.6(sy2013) X.
Alternate IDs:
Notes: Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F21G4.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATAACGGATGAATTAAGTACAAATGTATCGTTG. Right flanking sequence: GACAGGGAATTAAACCTTTTGAAATCGGCACAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTACAAATGTATCGTTGGAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616."
Proper citation: RRID:WB-STRAIN:WBStrain00055397 Copy
http://www.wormbase.org/db/get?name=WBStrain00055430
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00003964(pdi-3)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00003964(pdi-3), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: pdi-3(ve781[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Alternate IDs:
Notes: Homozygous viable. Deletion of 4472 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagtcgaagctgcaaacaataaataaataa ; Right flanking sequence: gggaacaccgacaaaaagttaaaaactaag. sgRNA #1: attacaaaagggaaacaacg; sgRNA #2: ttagagggcgagagattatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055430 Copy
http://www.wormbase.org/db/get?name=WBStrain00055396
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00008137(sfxn-1.4)
Genomic Alteration: WBGene00008137(sfxn-1.4)
Availability: unknown
References:
Synonyms: sfxn-1.4(sy2011) II.
Alternate IDs:
Notes: Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of sfxn-1.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTCCGCCGATTCTTGCTCGTCTCGTTCCATTT. Right flanking sequence: GCTGCTATTGCATTCGCCAATGCAATTAATATTCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCGAATGCAATAGCAGCAAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616."
Proper citation: RRID:WB-STRAIN:WBStrain00055396 Copy
http://www.wormbase.org/db/get?name=WBStrain00055436
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: C23G10.7(ve787[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Alternate IDs:
Notes: Homozygous viable. Deletion of 3575 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tccttgtatcgtccatttgaatgtcatcca ; Right flanking sequence: cagtgaaaaattaagcattagagcggtcaa. sgRNA #1: agtgaattttgtggcggctt; sgRNA #2: atcgtctcaaagctatgcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055436 Copy
http://www.wormbase.org/db/get?name=WBStrain00055435
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: H40L08.3(ve786[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs:
Notes: Homozygous viable. Deletion of 6197 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGTTTTGAGATTTAGCAAGTAAATTGAGA ; Right flanking sequence: AGGATAATAATCGTTTTACCAGAGGCAAAG. sgRNA #1: ACGGAGTGTTCTAGGCGTCG; sgRNA #2: GTTTCACATCTCCGTTTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055435 Copy
http://www.wormbase.org/db/get?name=WBStrain00055388
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00017904(lim-8)
Genomic Alteration: WBGene00017904(lim-8)
Availability: unknown
References:
Synonyms: lim-8(sy1989) III.
Alternate IDs:
Notes: Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of lim-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ccacttttcagTCAAAAGAAGAAATCCTCCAAGT. Right flanking sequence: GAATTCGGCGTCTCGACCAGCACTGCCACGTCAGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTCGAGACGCCGAATTCACT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616."
Proper citation: RRID:WB-STRAIN:WBStrain00055388 Copy
http://www.wormbase.org/db/get?name=WBStrain00055421
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: T01B7.5(ve771[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II.
Alternate IDs:
Notes: Made_by: RG KO Group|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous early larval arrest. Deletion of 3511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve771 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaattgctaatttttggatttcagatacta ; Right flanking sequence: gttgaatgtgtttttgtgtgcccggtcact. sgRNA #1: gaactATGTCATCAAGGAAG; sgRNA #2: cgactaaaagggcaaacgag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00055421 Copy
http://www.wormbase.org/db/get?name=WBStrain00055423
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: F13H10.3(ve773[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Alternate IDs:
Notes: Homozygous viable. Deletion of 3011 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATACATAAACTAATCCAGAAATTGATCCCA ; Right flanking sequence: AGGACATTTTTTCACTGCAAATCGCCGAAT. sgRNA #1: CAACTTAACTTCCAGATATG; sgRNA #2: TACACCAATAGCTCCATACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055423 Copy
http://www.wormbase.org/db/get?name=WBStrain00055389
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00017513(F16F9.1)
Genomic Alteration: WBGene00017513(F16F9.1)
Availability: unknown
References:
Synonyms: F16F9.1(sy1991) X.
Alternate IDs:
Notes: Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F16F9.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACCATCATATAGCCCTCGCCGCCCTCCTCCACCA. Right flanking sequence: TACGAAGAGCAGAACAATCGAAATGCAAAAAAGgtg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTTCTGCTCTTCGTATGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616."
Proper citation: RRID:WB-STRAIN:WBStrain00055389 Copy
http://www.wormbase.org/db/get?name=WBStrain00055422
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: C25F6.7(ve772[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs:
Notes: Homozygous viable. Deletion of 2402 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGTGATTTTTCTATACCCAGTCAGAATT ; Right flanking sequence: AGGTACAACTGGAAGAGATCAGCTTCTAAA. sgRNA #1: TCAGATGACGATCTTCACTA; sgRNA #2: CGCATCAATGGCTGGTGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055422 Copy
http://www.wormbase.org/db/get?name=WBStrain00055429
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: slc-17.2(ve780[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Alternate IDs:
Notes: Homozygous viable. Deletion of 2131 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCAATCTTTTCTCCTTCTCTAAGTGGAGC ; Right flanking sequence: CGGTTTGGTAGTAGCCCCTTCCATAATTAT. sgRNA #1: CATCTCATGGCCTTCTTCGG; sgRNA #2: TACTTTACGATCAACTCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055429 Copy
http://www.wormbase.org/db/get?name=WBStrain00055428
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010769(asah-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010769(asah-1)
Availability: unknown
References:
Synonyms: asah-1(ve779[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Alternate IDs:
Notes: Homozygous viable. Deletion of 2292 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGAGAATTGTCGGTTTTGTTGCTGGTGGC ; Right flanking sequence: GAGACTTCTCGCTTCGAGACCATCCTTCAA. sgRNA #1: TGTGTGCGCCGCAAAGCATG; sgRNA #2: GACGGACATGAGGACGGTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055428 Copy
http://www.wormbase.org/db/get?name=WBStrain00055425
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001016(dna-2)|WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001016(dna-2), WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: dna-2(ve776[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II.
Alternate IDs:
Notes: Made_by: RG KO Group|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Maternal effect sterile. Deletion of 3982 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that produce sterile progeny (ve776 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatgtctgctgcccgcccgcccgttgcct ; Right flanking sequence: ccttttttactcatttattagatttctcac. sgRNA #1: gattctggctgcgaaatacg; sgRNA #2: cgggaattTTACAGTTGAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00055425 Copy
http://www.wormbase.org/db/get?name=WBStrain00055424
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: C01A2.4(ve775[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Alternate IDs:
Notes: Homozygous viable. Deletion of 1714 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAATCGGAATTTTCCAAGGATGAACATT ; Right flanking sequence: AGGTTTCCAGCACTGCTCCGGCTGATTTCG. sgRNA #1: TTCTCGAAGCCCGATCCAAA; sgRNA #2: TGTCCCTGCTCTTCCCACAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055424 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
