Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00031505
Source Database: WormBase (WB)
Affected Genes: WBGene00017277(F09C12.2)
Genomic Alteration: WBGene00017277(F09C12.2)
Availability: available
Source References: EMPTY
Synonyms: F09C12.2(ok582) II.
Alternate IDs: WB-STRAIN:RB792, CGC_RB792
Notes: F09C12.2. Homozygous. Outer Left Sequence: ATGACCGTGGAGTGTGACAA. Outer Right Sequence: CGATCCCTCACTCGGATAAA. Inner Left Sequence: GGTTGCAGGGGTTCTGAATA. Inner Right Sequence: CTTGGCTCATTTTTGACGGT. Inner primer WT PCR product: 3078.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031505 Copy
http://www.wormbase.org/db/get?name=WBStrain00031504
Source Database: WormBase (WB)
Affected Genes: WBGene00002019(hsp-16.48)
Genomic Alteration: WBGene00002019(hsp-16.48)
Availability: available
Source References: PMID:32009302, PMID:38987256
Synonyms: hsp-16.48(ok577) V.
Alternate IDs: WB-STRAIN:RB791, CGC_RB791
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T27E4.3, T27E4.8. Homozygous. Outer Left Sequence: TGGCATTCCTTCCTTATTGC. Outer Right Sequence: TGAGAAGCCGAGTAGCTGGT. Inner Left Sequence: GTAAGGCTTTCTGCCGTTTG. Inner Right Sequence: TGAGGGCCCTGTAGAAGTTG. Inner primer WT PCR product: 3051."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061877 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00031504 Copy
http://www.wormbase.org/db/get?name=WBStrain00031503
Source Database: WormBase (WB)
Affected Genes: WBGene00000221(atf-4)
Genomic Alteration: WBGene00000221(atf-4)
Availability: available
Source References: PMID:38799567, PMID:39436952
Synonyms: atf-4(ok576) X.
Alternate IDs: WB-STRAIN:RB790, CGC_RB790
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T04C10.4. Homozygous. Outer Left Sequence: TGTCGCCAGTGTTGGAATAA. Outer Right Sequence: ACCGTGAAGATGGAGGTGAC. Inner Left Sequence: CGTGCGCTTCAAGTTCACTA. Inner Right Sequence: GCCAGAAGGCTACTTGGTTG. Inner primer WT PCR product: 2701."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031503 Copy
http://www.wormbase.org/db/get?name=WBStrain00031588
Source Database: WormBase (WB)
Affected Genes: WBGene00001470(baz-2)|WBGene00044448(ZK783.6)
Genomic Alteration: WBGene00001470(baz-2), WBGene00044448(ZK783.6)
Availability: available
Source References: EMPTY
Synonyms: baz-2&ZK783.6(ok722) III.
Alternate IDs: WB-STRAIN:RB875, CGC_RB875
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK783.4 Homozygous. Outer Left Sequence: TCAGCTATCAAGCTCCGGTT. Outer Right Sequence: TGAACGTGCTCTTCATCGTC. Inner Left Sequence: CGTCATACGCCCAGAAGAAT. Inner Right Sequence: ACCAGTTGGTGAGAAATCCG. Inner Primer PCR Length: 3113. Estimated Deletion Size: about 1500 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00031588 Copy
http://www.wormbase.org/db/get?name=WBStrain00031587
Source Database: WormBase (WB)
Affected Genes: WBGene00010915(nte-2)
Genomic Alteration: WBGene00010915(nte-2)
Availability: available
Source References: EMPTY
Synonyms: M110.7(ok721) II.
Alternate IDs: WB-STRAIN:RB874, CGC_RB874
Notes: M110.7. Homozygous. Outer Left Sequence: ACTTCATTCATCGCGAATCC. Outer Right Sequence: TTCTTGCACATCCAAGCAAC. Inner Left Sequence: GGAAAGTGTTTGAATGCGGT. Inner Right Sequence: AAGACTCACAGCTGCCTGGT. Inner primer WT PCR product: 2923.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031587 Copy
http://www.wormbase.org/db/get?name=WBStrain00031507
Source Database: WormBase (WB)
Affected Genes: WBGene00022423(nhr-41)
Genomic Alteration: WBGene00022423(nhr-41)
Availability: available
Source References: EMPTY
Synonyms: nhr-41(ok584) IV.
Alternate IDs: WB-STRAIN:RB794, CGC_RB794
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y77E11A.5. Homozygous. Outer Left Sequence: AGGCTCACCAAGAGCTTCAA. Outer Right Sequence:AGTAACCCGAGAATTTCGCA . Inner Left Sequence: TCAATTCGAAGCCCTTTCAC. Inner Right Sequence: CATTGATGAAACCTTCCCGT. Inner primer WT PCR product: 2853."
Proper citation: RRID:WB-STRAIN:WBStrain00031507 Copy
http://www.wormbase.org/db/get?name=WBStrain00031593
Source Database: WormBase (WB)
Affected Genes: WBGene00022278(rcor-1)
Genomic Alteration: WBGene00022278(rcor-1)
Availability: available
Source References: EMPTY
Synonyms: Y74C9A.4(ok727).
Alternate IDs: WB-STRAIN:RB880, CGC_RB880
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y74C9A.4. Homozygous. Outer Left Sequence: CATCGATTGGATCAGCTTCA. Outer Right Sequence: GCGCCCAAAAATTACAAAAA. Inner Left Sequence: GCCTGATGGTTTACGGAGAA. Inner Right Sequence: TTGATTTTCAGACGTGCAGC. Inner Primer WT PCR Product: 3251. Deletion size: 696 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00031593 Copy
http://www.wormbase.org/db/get?name=WBStrain00031592
Source Database: WormBase (WB)
Affected Genes: WBGene00006941(wnk-1)
Genomic Alteration: WBGene00006941(wnk-1)
Availability: available
Source References: PMID:37527037
Synonyms: wnk-1(ok266) IV.
Alternate IDs: WB-STRAIN:RB879, CGC_RB879
Notes: C46C2.1 Homozygous. Outer Left Sequence: CAAAACGACTCTGCTCCACA. Outer Right Sequence: GCAATTGTGCATGGTTTGTC. Inner Left Sequence: CAACGACATCATCTCCATCG. Inner Right Sequence: TGTCAAGTCGACACGAGACC. Inner Primer PCR Length: 3092. Estimated Deletion Size: about 1000 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031592 Copy
http://www.wormbase.org/db/get?name=WBStrain00031591
Source Database: WormBase (WB)
Affected Genes: WBGene00011904(hlb-1)
Genomic Alteration: WBGene00011904(hlb-1)
Availability: available
Source References: EMPTY
Synonyms: T21H8.1(ok725) X.
Alternate IDs: WB-STRAIN:RB878, CGC_RB878
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T21H8.1. Homozygous. Outer Left Sequence: CCATTCGTATGGTGTGCAAG. Outer Right Sequence: ACGCATTATTCGGATTCTGG. Inner Left Sequence: CATGGTCCATTTCGTTCTGA. Inner Right Sequence: AACAGGAGTGCCCACGTTAC. Inner primer WT PCR product: 2713."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031591 Copy
http://www.wormbase.org/db/get?name=WBStrain00031590
Source Database: WormBase (WB)
Affected Genes: WBGene00011201(nth-1)
Genomic Alteration: WBGene00011201(nth-1)
Availability: available
Source References: PMID:34496255, PMID:39149885
Synonyms: nth-1(ok724) III.
Alternate IDs: WB-STRAIN:RB877, CGC_RB877
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"R10E4.5. Homozygous. Outer Left Sequence: AGAATGCGGTAAAACGATGC. Outer Right Sequence: TGATGAATTGCATCCGAAAA. Inner Left Sequence: ACAGTGAATATGACGCGCAA. Inner Right Sequence: GCACACCTTCCTTTCTCTGC. Inner primer WT PCR product: 2170."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061894 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00031590 Copy
http://www.wormbase.org/db/get?name=WBStrain00031513
Source Database: WormBase (WB)
Affected Genes: WBGene00002029(hst-2)
Genomic Alteration: WBGene00002029(hst-2)
Availability: available
Source References: EMPTY
Synonyms: hst-2(ok595) X.
Alternate IDs: WB-STRAIN:RB800, CGC_RB800
Notes: C34F6.4. Homozygous. Outer Left Sequence: CCCTATCTACTGCCAGCGAG. Outer Right Sequence: GCGTCAGCAAAAAGAACACA. Inner Left Sequence: GAAATCGATGGAGGACGAGA. Inner Right Sequence: GCTGTGGAAAAAGCGAAAAG. Inner primer WT PCR product: 3131.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031513 Copy
http://www.wormbase.org/db/get?name=WBStrain00031511
Source Database: WormBase (WB)
Affected Genes: WBGene00004508(rrf-1)
Genomic Alteration: WBGene00004508(rrf-1)
Availability: available
Source References: PMID:33673074
Synonyms: rrf-1(ok589) I.
Alternate IDs: WB-STRAIN:RB798, CGC_RB798
Notes: F26A3.8. Homozygous. Outer Left Sequence: AGTCAGGAATTCGCTCAGGA. Outer Right Sequence: TCAATCATTGGCAGGTTTCA. Inner Left Sequence: GCTTGGCAATTCTTCTTTGC. Inner Right Sequence: TCGAAGGGATTCAATTCGTC. Inner primer WT PCR product: 3018.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00061131 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00031511 Copy
http://www.wormbase.org/db/get?name=WBStrain00031599
Source Database: WormBase (WB)
Affected Genes: WBGene00000080(adr-2)
Genomic Alteration: WBGene00000080(adr-2)
Availability: available
Source References: EMPTY
Synonyms: adr-2(ok735) III.
Alternate IDs: WB-STRAIN:RB886, CGC_RB886
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T20H4.4. Homozygous. Outer Left Sequence: CTCCATATTCGCTTCCGTGT. Outer Right Sequence: AGAACACGCTCTTCGTCGAT. Inner Left Sequence: CACGATGCTGCATGAGATTT. Inner Right Sequence: AGCTCGCTTCCAATCTTCAA. Inner primer WT PCR product: 2144."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031599 Copy
http://www.wormbase.org/db/get?name=WBStrain00031518
Source Database: WormBase (WB)
Affected Genes: WBGene00003834(nxf-1)|WBGene00003835(nxf-2)
Genomic Alteration: WBGene00003834(nxf-1), WBGene00003835(nxf-2)
Availability: available
Source References: EMPTY
Synonyms: nxf-1&nxf-2(ok611) V.
Alternate IDs: WB-STRAIN:RB805, CGC_RB805
Notes: C15H11.6. Homozygous. Outer Left Sequence: GCGGACGTACCATTCAAAGT. Outer Right Sequence: ACTGCAGCCTGAAAGTTCGT. Inner Left Sequence: GGCAGAAGTAAGGCTTGCAC. Inner Right Sequence: CATGGATTGACACACCTTGC. Inner primer WT PCR product: 3088.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031518 Copy
http://www.wormbase.org/db/get?name=WBStrain00031562
Source Database: WormBase (WB)
Affected Genes: WBGene00002182(kap-1)
Genomic Alteration: WBGene00002182(kap-1)
Availability: available
Source References: PMID:32916106, PMID:38302462
Synonyms: kap-1(ok676) II.
Alternate IDs: WB-STRAIN:RB849, CGC_RB849
Notes: F08F8.3. Homozygous. Outer Left Sequence: CATTTTGCTCGCTGTGAGAC. Outer Right Sequence: AACTTCTCGAACCACTGCGT. Inner Left Sequence: CCATGAATCCATGCCTCTTT. Inner Right Sequence: ATCATCAATTTGGCATGCTG. Inner primer WT PCR product: 3332.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060242 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00031562 Copy
http://www.wormbase.org/db/get?name=WBStrain00031560
Source Database: WormBase (WB)
Affected Genes: WBGene00007593(C14H10.3)
Genomic Alteration: WBGene00007593(C14H10.3)
Availability: available
Source References: EMPTY
Synonyms: C14H10.3(ok674) X.
Alternate IDs: WB-STRAIN:RB847, CGC_RB847
Notes: C14H10.3. Homozygous. Outer Left Sequence: GCGAAAACTGAACACGGAAT. Outer Right Sequence: CCTTAACATGCGGCCATTAT. Inner Left Sequence: GAAAAGACGCACGAGGAAAG. Inner Right Sequence: ATTTCTGACGACTGGTTGGG. Inner primer WT PCR product: 3138.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031560 Copy
http://www.wormbase.org/db/get?name=WBStrain00031568
Source Database: WormBase (WB)
Affected Genes: WBGene00012532(crp-1)
Genomic Alteration: WBGene00012532(crp-1)
Availability: available
Source References: EMPTY
Synonyms: Y32F6B.3(ok685) V.
Alternate IDs: WB-STRAIN:RB855, CGC_RB855
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y32F6B.3. Homozygous. Outer Left Sequence: CCCATTCTCGTCCACTTTGT. Outer Right Sequence: GTGATCCCATTCCAAAATGC. Inner Left Sequence: GAAGACAACGCCTCTGGAAG. Inner Right Sequence: AGGAAAATGGGTGAGCAATG. Inner primer WT PCR product: 2112."
Proper citation: RRID:WB-STRAIN:WBStrain00031568 Copy
http://www.wormbase.org/db/get?name=WBStrain00031601
Source Database: WormBase (WB)
Affected Genes: WBGene00000403(casy-1)
Genomic Alteration: WBGene00000403(casy-1)
Availability: available
Source References: EMPTY
Synonyms: casy-1(ok739) II.
Alternate IDs: WB-STRAIN:RB888, CGC_RB888
Notes: B0034.3. Homozygous. Outer Left Sequence: CCTTCGCGGTTTTTATTGAA. Outer Right Sequence: CCATCATTTGTGCAATACGC. Inner Left Sequence: AAAGAAGAAAATCGTGGCGA. Inner Right Sequence: ATTGCTCACATCGAGCCTCT. Inner primer WT PCR product: 2331.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031601 Copy
http://www.wormbase.org/db/get?name=WBStrain00031566
Source Database: WormBase (WB)
Affected Genes: WBGene00001434(fkh-2)
Genomic Alteration: WBGene00001434(fkh-2)
Availability: available
Source References: EMPTY
Synonyms: T14G12.4(ok683) X.
Alternate IDs: WB-STRAIN:RB853, CGC_RB853
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T14G12.4. Homozygous. Outer Left Sequence: AATAATCGACGTTTGACGGC. Outer Right Sequence: TAATCATCCTTGGAAACGCC. Inner Left Sequence: TTGGTGTTACAAGCACGGAA. Inner Right Sequence: ATCGCAGTGGTTAGTCCCAC. Inner primer WT PCR product: 2102."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031566 Copy
http://www.wormbase.org/db/get?name=WBStrain00031574
Source Database: WormBase (WB)
Affected Genes: WBGene00006942(wrk-1)
Genomic Alteration: WBGene00006942(wrk-1)
Availability: available
Source References: EMPTY
Synonyms: F41D9.3(ok695) X.
Alternate IDs: WB-STRAIN:RB861, CGC_RB861
Notes: F41D9.3. Homozygous. Outer Left Sequence: TGACACTGTTGCAGTCCTCC. Outer Right Sequence: ACAGAAGTCGTCGCTGTTGA. Inner Left Sequence: GCAGAAAGTGATCCGCATTT. Inner Right Sequence: TAACTACTCGTGCGCATTGG. Inner primer WT PCR product: 3367.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031574 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.