Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
endu-2(by190[endu-2::eGFP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054668 | Caenorhabditis elegans | endu-2(by190[endu-2::eGFP]) X. | eGFP tag inserted into the endogenous endu-2 locus. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications. | WBGene00019779(endu-2) | WBGene00019779(endu-2) | WB-STRAIN:WBStrain00054668 | WormBase (WB) | WB | unknown | PMID:37443152 | 2026-08-29 09:28:39 | 0 | |||
|
shc-1(ok198) I; zIs356 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054667 | Caenorhabditis elegans | shc-1(ok198) I; zIs356 IV. | zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)] IV. Tumorous germline with degeneration of surrounding extracellular matrix & disrupted gonadal basement membrane. Reference: Qi W, et al. PLoS Genet. 2012;8(8):e1002836. doi: 10.1371/journal.pgen.1002836. | WBGene00018788(shc-1) | WBGene00018788(shc-1) | WB-STRAIN:WBStrain00054667 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:39 | 0 | ||||
|
juIs145 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054700 | Caenorhabditis elegans | juIs145 II. | juIs145 [flp-13p::GFP + lin-15(+)] II. GFP expression in ASE, ASG, ASK, I5 and DD1-DD6. Reference: Wu Z, et al. Proc Natl Acad Sci USA. 2007 Sep 18;104(38):15132-7. PMID: 17848506. | WB-STRAIN:WBStrain00054700 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:40 | 0 | ||||||
|
pod-2(tn1765[gfp::3xflag::pod-2]) II. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00054709 | Caenorhabditis elegans | pod-2(tn1765[gfp::3xflag::pod-2]) II. | Homozygous viable, gfp expression in intestine, hypodermis, somatic gonad, excretory duct, CAN neuron. Reference: Starich et al. eLife 2020;9:e58619. DOI: https: | WBGene00004076(pod-2) | WBGene00004076(pod-2) | WB-STRAIN:WBStrain00054709 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:40 | 1 | ||||
|
lite1(ce314) X; domIs355. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054708 | Caenorhabditis elegans | lite1(ce314) X; domIs355. | domIs355 [mec3p::QF + mec4p::QS + QUAS::CoChR::GFP + unc122p::RFP]. High sensitivity blue-light optogenetic line for FLP neurons. Transgenic animals expressing the high-sensitivity blue light-activated channelrhodopsin CoChR into FLP using the Q-system combining mec-3p and mec-4p promoters. In animals grown on all trans-retinal-containing medium, low intensity blue light stimuli trigger reversal responses. Animals have red coelomocytes. The transgene was integrated with UV, and outcrossed 2x to parental ce314 mutant strain KG1180. Reference: Schild LC & Glauser DA. Genetics. 2015 Aug;200(4):1029-34. doi: 10.1534/genetics.115.177956. PMID: 26022242. | WB-STRAIN:WBStrain00054708 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:40 | 0 | ||||||
|
sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054651 | Caenorhabditis elegans | sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV. | Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989. | WBGene00007111(sart-3) | WBGene00007111(sart-3) | WB-STRAIN:WBStrain00054651 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:39 | 0 | ||||
|
ZK813.1(viz166[fln-1p::ZK813.1]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054653 | Caenorhabditis elegans | ZK813.1(viz166[fln-1p::ZK813.1]) X. | Made_by: Jake Seemann|"The endogenous promoter of ZK813.1 (1046 bp) was replaced with the fln-1 promoter (947 bp) to limit the expression of ZK813.1 to the spermatheca and allow analysis of RNA transfer from soma to oocytes. Reference: Trimmer KA, et al. Cell Rep. 2023 May 23;42(6):112544.doi: 10.1016/j.celrep.2023.112544. PMID: 37227820.." | WBGene00022048(fln-1) | WBGene00022048(fln-1) | WB-STRAIN:WBStrain00054653 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:39 | 0 | ||||
|
sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054652 | Caenorhabditis elegans | sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV. | Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989. | WBGene00007111(sart-3) | WBGene00007111(sart-3) | WB-STRAIN:WBStrain00054652 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:39 | 0 | ||||
|
pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054654 | Caenorhabditis elegans | pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. | Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC)encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases.Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017. | WBGene00004076(pod-2)|WBGene00004258(pyc-1)|WBGene00009319(mccc-1)|WBGene00017864(pcca-1) | WBGene00004076(pod-2), WBGene00004258(pyc-1), WBGene00009319(mccc-1), WBGene00017864(pcca-1) | WB-STRAIN:WBStrain00054654 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:39 | 0 | ||||
|
mrp-1(pk89) X; acEx174. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054657 | Caenorhabditis elegans | mrp-1(pk89) X; acEx174. | acEx174 [ges-1p::mrp-1::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. Translational fusion of MRP-1::GFP driven by intestine-specific ges-1 promoter. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.|"Made_by: Jonathan Lalsiamthara" | WBGene00003407(mrp-1) | WBGene00003407(mrp-1) | WB-STRAIN:WBStrain00054657 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:39 | 0 | ||||
|
rack-1(rns8[rack-1::mScarlet]] IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054763 | Caenorhabditis elegans | rack-1(rns8[rack-1::mScarlet]] IV. | mScarlet tag inserted into endogenous rack-1 locus. Ubiquitous mScarlet expression. | WBGene00010556(rack-1) | WBGene00010556(rack-1) | WB-STRAIN:WBStrain00054763 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:41 | 0 | ||||
|
rps-6(rns6[rps-6::mCherry]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054762 | Caenorhabditis elegans | rps-6(rns6[rps-6::mCherry]) I. | mCherry tag inserted at 3' end of endogenous rps-6 locus. Reduced thermotolence at 35C compared to N2 controls. Reference: Somers H, et al. Cell Reports Methods. (2022) Apr 25;2(4):100203 PMID: 35497499 | WBGene00004475(rps-6) | WBGene00004475(rps-6) | WB-STRAIN:WBStrain00054762 | WormBase (WB) | WB | unknown | PMID:39284915 PMID:39652010 |
2026-08-29 09:28:41 | 0 | |||
|
cyb-2.2(q911[3xMyc::cyb-2.2]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054802 | Caenorhabditis elegans | cyb-2.2(q911[3xMyc::cyb-2.2]) I. | 3xMyc tag inserted at N-terminus of endogenous cyb-2.2 locus. | WB-STRAIN:WBStrain00054802 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:42 | 0 | ||||||
|
cyd-1(q917[cyd-1::3xMyc]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054804 | Caenorhabditis elegans | cyd-1(q917[cyd-1::3xMyc]) II. | Internal 3xMyc tag inserted into endogenous cyd-1 locus. | WBGene00000870(cyd-1) | WBGene00000870(cyd-1) | WB-STRAIN:WBStrain00054804 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:42 | 0 | ||||
|
cyb-3(q914[cyb-3::3xMyc]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054803 | Caenorhabditis elegans | cyb-3(q914[cyb-3::3xMyc]) V. | Internal 3xMyc tag inserted into endogenous cyb-3 locus. | WBGene00000868(cyb-3) | WBGene00000868(cyb-3) | WB-STRAIN:WBStrain00054803 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:42 | 0 | ||||
|
bli-1(wrd84[bli-1::linker::mNeonGreen::3xFLAG(internal)::linker]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054764 | Caenorhabditis elegans | bli-1(wrd84[bli-1::linker::mNeonGreen::3xFLAG(internal)::linker]) II. | Internal mNeonGreen::3xFLAG tags with linker sequences inserted into endogenous bli-1 locus. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https: | WBGene00000251(bli-1) | WBGene00000251(bli-1) | WB-STRAIN:WBStrain00054764 | WormBase (WB) | WB | unknown | PMID:38924277 | 2026-08-29 09:28:42 | 0 | |||
|
cye-1(q920[3xMyc::cye-1]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054805 | Caenorhabditis elegans | cye-1(q920[3xMyc::cye-1]) I. | 3xMyc tag inserted at N-terminus of endogenous cye-1 locus. | WBGene00000871(cye-1) | WBGene00000871(cye-1) | WB-STRAIN:WBStrain00054805 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:42 | 0 | ||||
|
pqe-1(utx65[mScarlet-I-C1::3xMyc::pqe-1]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054750 | Caenorhabditis elegans | pqe-1(utx65[mScarlet-I-C1::3xMyc::pqe-1]) III. | Made_by: Ann Houghton (Glow Worms '22)|"N-terminal tag of PQE-1 via CRISPR/Cas9 knock-in of mScarlet at pqe-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd 5 CCAGATGCGAAAGCGAACAG 3 ; rev 5 TGTACTTACCGGAATCGGCG 3. Left flank: 5' ttaataatcattccagcaagtatctcagcc 3'; Right flank: 5' ATGTTTAATGGCGGCTATGGATCTGGAAAC 3; sgRNA: atctcagccATGTTTAATGG; Cas9/sgRNA plasmid: pGLOW143; mScarlet^SEC^3xMyc plasmid: pGLOW142; SEC insertion allele strain: GLW84." | WBGene00004095(pqe-1) | WBGene00004095(pqe-1) | WB-STRAIN:WBStrain00054750 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:41 | 0 | ||||
|
aSi13 II; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054757 | Caenorhabditis elegans | aSi13 II; unc-119(ed3) III. | aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3 (delta)HygR + 3 (delta)mScarlet-I::PEST]II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https: | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00054757 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:41 | 0 | ||||
|
flp-11(syb1445[flp-11::SL2::unc-58(L428F)::linker::mKate2]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054759 | Caenorhabditis elegans | flp-11(syb1445[flp-11::SL2::unc-58(L428F)::linker::mKate2]) X. | Made_by: Bringmann lab|"unc-58(L428F) was knocked into the endogenous locus of flp-11 to express a sodium channel in RIS that causes strong overactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https:" | WBGene00001454(flp-11)|WBGene00006792(unc-58) | WBGene00001454(flp-11), WBGene00006792(unc-58) | WB-STRAIN:WBStrain00054759 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:41 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
