Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00054541

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37078421
Synonyms: cec-5(tm6207) him-8(e1489) IV
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054541 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054542

Source Database: WormBase (WB)
Affected Genes: WBGene00017990(cec-4)|WBGene00017993(cec-5)|WBGene00021913(cec-8)
Genomic Alteration: WBGene00017990(cec-4), WBGene00017993(cec-5), WBGene00021913(cec-8)
Availability: unknown
Source References: PMID:37078421
Synonyms: cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV.
Notes: Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Proper citation: RRID:WB-STRAIN:WBStrain00054542 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054548

Source Database: WormBase (WB)
Affected Genes: WBGene00012802(set-25)|WBGene00019883(met-2)
Genomic Alteration: WBGene00012802(set-25), WBGene00019883(met-2)
Availability: unknown
Source References: PMID:37078421
Synonyms: met-2(ok2307) set-25(n5021) III.
Notes: Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2.

Proper citation: RRID:WB-STRAIN:WBStrain00054548 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054545

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37078421
Synonyms: fjDf1 fjDf2 fjDf3 fjDf4 X.
Notes: CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Proper citation: RRID:WB-STRAIN:WBStrain00054545 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054547

Source Database: WormBase (WB)
Affected Genes: WBGene00007297(vsra-1)|WBGene00017641(csr-1)
Genomic Alteration: WBGene00007297(vsra-1), WBGene00017641(csr-1)
Availability: unknown
Source References: PMID:37078421
Synonyms: vsra-1(tm1637) I; csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV.
Notes: Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in homozygous tm1637; fj54 double mutants. The vsra-1 mutation enhances the defects caused by the csr-1 mutation. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. tm1637 can be detected by PCR with the following primers: AAGCAGTTCTTCAAGACTGGTC and TTGTCCACTCGCACTTTGTG. The fj54 deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Proper citation: RRID:WB-STRAIN:WBStrain00054547 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054646

Source Database: WormBase (WB)
Affected Genes: WBGene00001804(gur-3)
Genomic Alteration: WBGene00001804(gur-3)
Availability: unknown
Source References: PMID:38194919
Synonyms: gur-3(ok2245) X; wtfIs5.
Notes: wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a gur-3(ok2245) mutant background. Derived from parental strain AML14 by integration of wtfEx4. Reference: Gauthey W, et al. Curr Biol. 2024 Jan 8;34(1):R14-R15. doi: 10.1016/j.cub.2023.10.043. PMID: 38194919.|"wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. Derived from AML14 by integration of wtfEx4. Reference: Nguyen JP, et al. PLoS Comput Biol. 2017 May 18;13(5):e1005517."

Proper citation: RRID:WB-STRAIN:WBStrain00054646 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054696

Source Database: WormBase (WB)
Affected Genes: WBGene00020706(atg-9)
Genomic Alteration: WBGene00020706(atg-9)
Availability: unknown
Source References: EMPTY
Synonyms: atg-9(ola511[delta AP]) V.
Notes: Made_by: InVivo Biosystems|"ola511 is aCRISPR-engineered allele deleting a conserved sorting motif in ATG-9, causing a 2- to 3-fold decrease in LGG-1-containing puncta (and therefore autophagosomes) in the AIY neurites. Reference: Yang S, et al. Neuron. 2022 Mar 2;110(5):824-840.e10."

Proper citation: RRID:WB-STRAIN:WBStrain00054696 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054692

Source Database: WormBase (WB)
Affected Genes: WBGene00003285(mir-57)|WBGene00003514(myo-2)|WBGene00005016(sqt-1)
Genomic Alteration: WBGene00003285(mir-57), WBGene00003514(myo-2), WBGene00005016(sqt-1)
Availability: unknown
Source References: EMPTY
Synonyms: mir-57(umn34[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272]) II.
Notes: Made_by: Julie Knott & Marcus Vargas|"mir-57 pre-miRNA deletion strain deletion allele in which mir-57 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]"

Proper citation: RRID:WB-STRAIN:WBStrain00054692 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054735

Source Database: WormBase (WB)
Affected Genes: WBGene00010785(top-2)
Genomic Alteration: WBGene00010785(top-2)
Availability: unknown
Source References: EMPTY
Synonyms: ieSi57 ers55[top-2::degron::GFP] II.
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted into the endogenous top-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.|"Made_by: Ana Morao"

Proper citation: RRID:WB-STRAIN:WBStrain00054735 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054699

Source Database: WormBase (WB)
Affected Genes: WBGene00000962(dhc-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000962(dhc-1), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: dhc-1(lt45[dhc-1::GFP]) I; ltSi953 II; unc-119(ed3) III.
Notes: ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous dhc-1 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged dhc-1 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.

Proper citation: RRID:WB-STRAIN:WBStrain00054699 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054732

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:39259762
Synonyms: rhIs2.
Notes: rhIs2 [pat-3::HA::GFP]. rhIs2 contains cosmid-derived full-length pat-3, including 5 kb 5UTR and 1 kb 3 UTR, with HA and GFP(S65C) tags inserted prior to the pat-3 stop codon. Reference: Plenefisch JD, et al. Development. 2000 127(6):1197-207. doi: 10.1242/dev.127.6.1197.

Proper citation: RRID:WB-STRAIN:WBStrain00054732 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054731

Source Database: WormBase (WB)
Affected Genes: WBGene00018976(daam-1)
Genomic Alteration: WBGene00018976(daam-1)
Availability: unknown
Source References: EMPTY
Synonyms: daam-1(ups39) V.
Notes: Superficially wild-type. ups39 is a CRISPR-engineered deletion within daam-1. daam-1(ups39) encodes an in-frame stop codon near the start of its FH2-coding sequence, and a 1-nt frame shift due to the LoxP site, and is thus predicted encode a non-functional formin. Reference: Sundaramurthy S, et al. Cytoskeleton (Hoboken). 2020 Oct;77(10):422-441. doi: 10.1002/cm.21639. PMID: 33103378.

Proper citation: RRID:WB-STRAIN:WBStrain00054731 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054734

Source Database: WormBase (WB)
Affected Genes: WBGene00001086(dpy-27)
Genomic Alteration: WBGene00001086(dpy-27)
Availability: unknown
Source References: EMPTY
Synonyms: ieSi57 II; ers54[dpy-27::degron::GFP] III.
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron::GFP tag inserted into the endogenous dpy-27 locus. Dumpy, Him, X chromosome dosage compensation hypomorph. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.|"Made_by: Ana Morao"

Proper citation: RRID:WB-STRAIN:WBStrain00054734 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054684

Source Database: WormBase (WB)
Affected Genes: WBGene00001423(fib-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001423(fib-1), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: muIs252 II; unc-119(ed3) III; fib-1(mu498[wrmScarlet11::fib-1]) V.
Notes: muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

Proper citation: RRID:WB-STRAIN:WBStrain00054684 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054686

Source Database: WormBase (WB)
Affected Genes: WBGene00001423(fib-1)
Genomic Alteration: WBGene00001423(fib-1)
Availability: unknown
Source References: PMID:39652010
Synonyms: muIs257 I; fib-1(mu498[wrmScarlet11::fib-1]) V.
Notes: muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

Proper citation: RRID:WB-STRAIN:WBStrain00054686 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054685

Source Database: WormBase (WB)
Affected Genes: WBGene00001877(his-3)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001877(his-3), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: muIs252 II; unc-119(ed3) III; his-3(mu500[his-3::wrmScarlet11(x3)]) V.
Notes: muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

Proper citation: RRID:WB-STRAIN:WBStrain00054685 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054680

Source Database: WormBase (WB)
Affected Genes: WBGene00003230(mex-5)|WBGene00004896(smu-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00003230(mex-5), WBGene00004896(smu-2), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: cer227[mex-5p::SpG(smu-2 introns) + unc-119(+)] II; unc-119(ed3) III.
Notes: Made_by: Dmytro Kukhtar|"Missense mutations D1135L and S1136W, G1218K and E1219Q, and R1335Q and T1337R were introduced on the Cas9 gene at EG9615 strain, to cause endogenous expression of the Cas9 variant SpG. SpG is efficient for CRISPR on NGN PAM sites. Reference: Vicencio J, et al. Nature Communication, 2022. May 12;13(1):2601. doi: 10.1038/s41467-022-30228-4."

Proper citation: RRID:WB-STRAIN:WBStrain00054680 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054681

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00013025(vha-13)
Genomic Alteration: WBGene00006843(unc-119), WBGene00013025(vha-13)
Availability: unknown
Source References: EMPTY
Synonyms: muIs252 II; unc-119(ed3) III; vha-13(mu493[wrmScarlet11::vha-13]) V.
Notes: muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

Proper citation: RRID:WB-STRAIN:WBStrain00054681 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054724

Source Database: WormBase (WB)
Affected Genes: WBGene00001207(egl-43)
Genomic Alteration: WBGene00001207(egl-43)
Availability: unknown
Source References: EMPTY
Synonyms: bmdSi363 I; egl-43(bmd88[egl-43p::egl-43::LoxP::GFP::egl-43]) II.
Notes: bmdSi363 [^SEC^ser-2p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.|"Made_by: Yutong Xiao"

Proper citation: RRID:WB-STRAIN:WBStrain00054724 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054727

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bmdSi245 swsn-8(bmd222[(swsn-8p::swsn-8::GFP]) I.
Notes: bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.|"Made_by: Yutong Xiao"

Proper citation: RRID:WB-STRAIN:WBStrain00054727 Copy   

•   Source: Integrated Animals