Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00054579
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37908494
Synonyms: wrdSi73 wrd 110 [TiR1 aa391 AALITI insertion *wrdSi73] ; nhr-23(kry61(nhr-23::AID*-TEV-3xFLAG)) I; oxIs134[Pnas-37::GFP:rODC(pest)(pWD95@90ng/ul),lin-15(+)]; wrdEx45[eft-3p::TIR1::mRuby2::unc-54 3'UTR + mlc-1p::mNeonGreen]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054579 Copy
http://www.wormbase.org/db/get?name=WBStrain00054618
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37852248
Synonyms: EMPTY
Notes: [2023-10-20T18:09:05.93Z WBPerson712] New Strain: DOI10.1093/g3journal/jkad241 WBPaper00066106 MWU85 lin-15 (n765) ybIs2167 [eft-3::RET-1E4E5(+1)E6-GGS6-mCherry eft-3::RET-1E4E5(+1)E6-(+2)GGS6-EGFP lin-15 (+) pRG5271Neo] X; col-121(nx3)
Proper citation: RRID:WB-STRAIN:WBStrain00054618 Copy
http://www.wormbase.org/db/get?name=WBStrain00054619
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37852248
Synonyms: EMPTY
Notes: [2023-10-20T18:10:05.47Z WBPerson712] New Strain: DOI10.1093/g3journal/jkad241 WBPaper00066106 WBM535 wbmEx237 [pCH11 (eft-3::ret-1E4E5(+1)E6-(+2)-GGS6-mCherry) + pCH12 (eft-3::ret-1E4E5(+1)E6-GGS6-EGFP)]
Proper citation: RRID:WB-STRAIN:WBStrain00054619 Copy
http://www.wormbase.org/db/get?name=WBStrain00054564
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37500635
Synonyms: lgc-48(gk964294); zwEx175[Pflp-18::loxP::LacZ::STOP::loxP::mCherry::SL2::GFP, Pgpa-14::Cre]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054564 Copy
http://www.wormbase.org/db/get?name=WBStrain00054560
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37500635
Synonyms: kyEx3801[Psra-11::ChR2::GFP, Punc-122::dsRed]; zwIs143[Pflp-18::loxP::LacZ::STOP::loxP::mStrawberry, Pgpa-14::Cre, lin-15(+)]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054560 Copy
http://www.wormbase.org/db/get?name=WBStrain00054603
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38033425
Synonyms: srh-195(yum2500) II; srh-185(yum2493) srh-186(yum2494) srh-187(yum2495) srh-190(yum2496) srh-192(yum2497) srh-193(yum2498) srh-194(yum2499) srh-199(yum2501) srh-200(yum2502) srh-201(yum2503) srh-203(yum2504) V
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054603 Copy
http://www.wormbase.org/db/get?name=WBStrain00054605
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38033425
Synonyms: srh-146(yum2719) srh-147(yum2720) srh-148(yum2721) srh-166(yum2716) srh-167(yum2717) srh-169(yum2718) V
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054605 Copy
http://www.wormbase.org/db/get?name=WBStrain00054566
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37500635
Synonyms: inx-14(ag17); zwIs142[Psra-11::GFP]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054566 Copy
http://www.wormbase.org/db/get?name=WBStrain00054567
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37500635
Synonyms: acc-2(ok2216); kyEx3801[Psra-11::ChR2::GFP, Punc-122::dsRed]; zwEx277[Pflp-18::loxP::LacZ::STOP::loxP::acc-2(cDNA), Pflp-18::lox-P::LacZ::STOP::loxP::mCherry::SL2::GFP, Pgpa-14::Cre]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054567 Copy
http://www.wormbase.org/db/get?name=WBStrain00054569
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37500635
Synonyms: zwEx287[Punc-171::: inx-12ss, Punc-171:: inx-12as]; zwIs142[Psra-11::GFP]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054569 Copy
http://www.wormbase.org/db/get?name=WBStrain00054602
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38033425
Synonyms: srh-195(yum2500) II; srh-185(yum2493) srh-186(yum2494) srh-187(yum2495) srh-190(yum2496) srh-192(yum2497) srh-193(yum2498) srh-194(yum2499) srh-199(yum2501) V
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054602 Copy
http://www.wormbase.org/db/get?name=WBStrain00054607
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38033425
Synonyms: srh-146(yum2719) srh-147(yum2720) srh-148(yum2721) srh-149(yum2722) srh-154(yum2723) srh-159(yum2724) srh-166(yum2716) srh-167(yum2717) srh-169(yum2718) srh-174(yum2729) srh-177(yum2730) srh-178(yum2731) V
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054607 Copy
http://www.wormbase.org/db/get?name=WBStrain00054608
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38033425
Synonyms: srh-146(yum2719) srh-147(yum2720) srh-148(yum2721) srh-149(yum2722) srh-154(yum2723) srh-159(yum2724) srh-166(yum2716) srh-167(yum2717) srh-169(yum2718) srh-174(yum2729) srh-177(yum2730) srh-178(yum2731) srh-179(yum2732) srh-180(yum2733) srh-183(yum2736) V
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054608 Copy
http://www.wormbase.org/db/get?name=WBStrain00054609
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38033425
Synonyms: srh-288(yum2617) srh-289(yum2618) srh-290(yum2619) V
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054609 Copy
http://www.wormbase.org/db/get?name=WBStrain00054551
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37078421
Synonyms: csr-1(fj160); CeRep55 quadruple deletions (fj115, fj85, fj123, and fj120) X
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054551 Copy
http://www.wormbase.org/db/get?name=WBStrain00054553
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37078421
Synonyms: csr-1(fj163fj150) CeRep55 quadruple deletions (fj115, fj85, fj123, and fj120) X
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054553 Copy
http://www.wormbase.org/db/get?name=WBStrain00054550
Source Database: WormBase (WB)
Affected Genes: WBGene00001860(him-1)
Genomic Alteration: WBGene00001860(him-1)
Availability: unknown
Source References: PMID:37078421
Synonyms: him-1(e879) I; fjDf1 fjDf2 fjDf3 fjDf4 X.
Notes: The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
Proper citation: RRID:WB-STRAIN:WBStrain00054550 Copy
http://www.wormbase.org/db/get?name=WBStrain00054555
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37500635
Synonyms: lgc-49(tm6556); zwEx175[Pflp-18::loxP::LacZ::STOP::loxP::mCherry::SL2::GFP, Pgpa-14::Cre]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054555 Copy
http://www.wormbase.org/db/get?name=WBStrain00054556
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37500635
Synonyms: acc-3(ok3450); zwEx175[Pflp-18::loxP::LacZ::STOP::loxP::mCherry::SL2::GFP, Pgpa-14::Cre]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054556 Copy
http://www.wormbase.org/db/get?name=WBStrain00054540
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37078421
Synonyms: cec-4(ok3124) him-8(e1489) IV
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054540 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.