Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC1396 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036566 | Caenorhabditis elegans | +/mT1 II; klp-6(ok1869)/mT1 [dpy-10(e128)] III. | Mutagen:UV/TMP|"R144.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1869 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGCCAGATGAGGAAACAACA. External right primer: CTCAGGTGACACCAAAACGA. Internal left primer: TCGAAGATCTTGGCAGAGGT. Internal right primer: ACATACCCCAACTCAGTGGC. Internal WT amplicon: 3130 bp. Deletion size: 1991 bp. Deletion left flank: ATCGAGAAGGCTGTGTATGTGTGTCAACTT. Deletion right flank: AACAGAACGAGCTCTTCGTGAACTCCGAGA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00002218(klp-6) | WBGene00001072(dpy-10), WBGene00002218(klp-6) | WB-STRAIN:WBStrain00036566 | WormBase (WB) | WB | available | WB-STRAIN:VC1396, CGC_VC1396 | 2026-08-15 09:33:12 | 0 | |||
|
VC1442 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036601 | Caenorhabditis elegans | grd-2(ok1902) V. | F46B3.5. Superficially wild type. [NOTE: This strain apparently carries a patrially penetrant or heterozygous Rol in the background. It is present in the original stock received at the CGC.] External left primer: TGTCGAGTGCACAAGAAAGG. External right primer: CCGCAAAGTTTCTTAGCCTG. Internal left primer: CCGTGCAGGTAACCATCTTT. Internal right primer: TCCATGATCAAAACACACCG. Internal WT amplicon: 3162 bp. Deletion size: 1293 bp. Deletion left flank: GATTTTGCTTCCAGTATCCAATTCATCAAC. Deletion right flank: ATGTTGGCCTCCTGTTATAGTGAAGTTCAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001691(grd-2) | WBGene00001691(grd-2) | WB-STRAIN:WBStrain00036601 | WormBase (WB) | WB | available | WB-STRAIN:VC1442, CGC_VC1442 | 2026-08-15 09:33:13 | 0 | |||
|
VC1402 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036571 | Caenorhabditis elegans | mef-2(gk633) I. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W10D5.1. External left primer: CCCTGTTGGATCTCCTGAAA. External right primer: TCATCACACAACACACCACG. Internal left primer: AAGAAGGCAGGCTCGTGTAA. Internal right primer: CCACCTACTCCATACCGCAA. Internal WT amplicon: 1885 bp. Deletion size: 1075 bp. Deletion left flank: TATGAAAAATCATGGTAACCTCCAGAGATT. Deletion right flank: TAATTTTTATCAAAAAATTGTCAGAACATT." | WBGene00003182(mef-2) | WBGene00003182(mef-2) | WB-STRAIN:WBStrain00036571 | WormBase (WB) | WB | available | WB-STRAIN:VC1402, CGC_VC1402 | 2026-08-15 09:33:12 | 0 | |||
|
VC1509 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036651 | Caenorhabditis elegans | nhr-220(gk690) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T19H12.8. External left primer: CCTGGATTCGATTTTCGGTA. External right primer: GGCATCAGAAATGCTCCAAT. Internal left primer: AATAATGGCATCGGTTCTGG. Internal right primer: TCCAACCAAATGAGAGTCCC. Internal WT amplicon: 2272 bp. Deletion size: 672 bp. Deletion left flank: CCATTGGGGAAATTGCTTCAAACCCCGCAT. Deletion right flank: TTGTATTTTTTTCTCAAAGGTCTATAATTT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020591(nhr-220) | WBGene00020591(nhr-220) | WB-STRAIN:WBStrain00036651 | WormBase (WB) | WB | available | WB-STRAIN:VC1509, CGC_VC1509 | 2026-08-15 09:33:16 | 0 | |||
|
VC1508 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036650 | Caenorhabditis elegans | +/szT1 [lon-2(e678)] I; sulp-3(ok1953)/szT1 X. | F41D9.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1953 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTCGTAAGGGTAATTGGCA. External right primer: TCCAAGAAGGAGTGGTCCAG. Internal left primer: TTCATCAACAGCAGTTTGGC. Internal right primer: CAACGTGCATATCCCAACAG. Internal WT amplicon: 3086 bp. Deletion size: 2464 bp. Deletion left flank: GTTTCTGACATGACCTCTTCAGAATTTTCA. Deletion right flank: GAGGAAATCTGTTGATTAAATAATGAGTCA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003056(lon-2)|WBGene00018283(sulp-3) | WBGene00003056(lon-2), WBGene00018283(sulp-3) | WB-STRAIN:WBStrain00036650 | WormBase (WB) | WB | available | WB-STRAIN:VC1508, CGC_VC1508 | 2026-08-15 09:33:13 | 0 | |||
|
VC1511 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036652 | Caenorhabditis elegans | F32H5.1(ok2017) V/nT1 [qIs51] (IV;V). | F32H5.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2017 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTGACAGAGACTTCGG. External right primer: GAGTTCGCGGAAATTTATGG. Internal left primer: CTAGACGGCGATACCTGGAA. Internal right primer: TTTCCAACATCCCTGGAGAG. Internal WT amplicon: 2266 bp. Deletion size: 1489 bp. Deletion left flank: ATCGTAAGAAATCATACCATTCTCTCCAAA. Deletion right flank: GTTTCCGCTTTCCATAGTTTCTGTTTTTTG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00009347(F32H5.1) | WBGene00009347(F32H5.1) | WB-STRAIN:WBStrain00036652 | WormBase (WB) | WB | available | WB-STRAIN:VC1511, CGC_VC1511 | 2026-08-15 09:33:13 | 0 | |||
|
VC1513 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036654 | Caenorhabditis elegans | +/szT1 [lon-2(e678)] I; adt-1(ok1965)/szT1 X. | C02B4.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1965 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATACGACGACCTCAGTTGCC. External right primer: GCACAACTTTTGTCGGGTTT. Internal left primer: GTGTGACCCGTTATTCGCTT. Internal right primer: GCTCAGGACAACTTGCTTCC. Internal WT amplicon: 3370 bp. Deletion size: 1659 bp. Deletion left flank: TGATGCTTCCCCAGGCCTTATATCTACAAA. Deletion right flank: ATGGGGCGATTGGCTGCCGTGCTCTGTATC. Insertion Sequence: A.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000082(adt-1)|WBGene00003056(lon-2) | WBGene00000082(adt-1), WBGene00003056(lon-2) | WB-STRAIN:WBStrain00036654 | WormBase (WB) | WB | available | WB-STRAIN:VC1513, CGC_VC1513 | 2026-08-15 09:33:16 | 0 | |||
|
VC1516 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036656 | Caenorhabditis elegans | Y58G8A(gk1021) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y58G8A. External left primer: GGGCCAGTTGGTCAGAGATA. External right primer: GGGAAGTGATTCGTTCTCCA. Internal left primer: TGCACTCAAGATCAAACGGA. Internal right primer: CTAGACTGGGCGGCATTTAG. Internal WT amplicon: 2306 bp. Deletion size: 125 bp. Deletion left flank: ATTCAACAAGGGAAATGGGGGCTGGGTAAA. Deletion right flank: CTTTGAAGAGACACAGGTGTGAGTTTGCGG." | WB-STRAIN:WBStrain00036656 | WormBase (WB) | WB | available | WB-STRAIN:VC1516, CGC_VC1516 | 2026-08-15 09:33:14 | 0 | |||||
|
VC1520 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00036660 | Caenorhabditis elegans | nhr-130(gk710) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T01G6.8. External left primer: TTCGGATACTTTTCGGTTGC. External right primer: TTCCATTTTTACGGTCCTCG. Internal left primer: GATATGAGGTCCCGATCGAA. Internal right primer: TGAGGCAGATTGGTGTTCTG. Internal WT amplicon: 2444 bp. Deletion size: 1218 bp. Deletion left flank: TTTGAAGCTTCCGCAAAAATTTACATTCCC. Deletion right flank: AAAAAAAATACCGGAAAATAGGCTCCGCCC. Insertion Sequence: AAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003720(nhr-130) | WBGene00003720(nhr-130) | WB-STRAIN:WBStrain00036660 | WormBase (WB) | WB | available | WB-STRAIN:VC1520, CGC_VC1520 | 2026-08-15 09:33:16 | 1 | |||
|
VC1532 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036669 | Caenorhabditis elegans | Y58G8A(gk1022) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y58G8A. External left primer: GGGCCAGTTGGTCAGAGATA. External right primer: GGGAAGTGATTCGTTCTCCA. Internal left primer: TGCACTCAAGATCAAACGGA. Internal right primer: CTAGACTGGGCGGCATTTAG. Internal WT amplicon: 2306 bp. Deletion size: 210 bp. Deletion left flank: TACATTCAACAAGGGAAATGGGGGCTGGGT. Deletion right flank: TGGGCGACAAACTATTTTTTTCCGGCAACA." | WB-STRAIN:WBStrain00036669 | WormBase (WB) | WB | available | WB-STRAIN:VC1532, CGC_VC1532 | 2026-08-15 09:33:17 | 0 | |||||
|
VC1524 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036663 | Caenorhabditis elegans | nhr-117(gk691) V. | F16B4.12. Superficially wild type. External left primer: CATACGGCAAGTTCAGCAAA. External right primer: CTACCAACCTGGTCATGGCT. Internal left primer: TCGGGATTTGACAAGTTCGT. Internal right primer: GCCGACTGTTGTCAGGATCT. Internal WT amplicon: 1781 bp. Deletion size: 1010 bp. Deletion left flank: TCACAAATCACCTCATCGTAAAACATTTCA. Deletion right flank: CGAGTGCTAAAAGCGGGCTCCGCGCAGACT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003707(nhr-117) | WBGene00003707(nhr-117) | WB-STRAIN:WBStrain00036663 | WormBase (WB) | WB | available | WB-STRAIN:VC1524, CGC_VC1524 | 2026-08-15 09:33:16 | 0 | |||
|
VC1528 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036666 | Caenorhabditis elegans | unc-4(gk705) II. | F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 307 bp. Deletion left flank: TGCAAAGTATTTCACTACAGTTTTACTGTA. Deletion right flank: GCTTAATCCTGCTAGACTTCTACCACAAAA.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006744(unc-4) | WBGene00006744(unc-4) | WB-STRAIN:WBStrain00036666 | WormBase (WB) | WB | available | WB-STRAIN:VC1528, CGC_VC1528 | 2026-08-15 09:33:16 | 0 | |||
|
VC1527 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00036665 | Caenorhabditis elegans | nhr-68(gk708) V. | H12C20.3. External left primer: CGGTTCTAATCCTCCGTCAA. External right primer: AGCGCACCTGTAAATTGCTT. Internal left primer: TGCCTTGTTTGCCAAGATTT. Internal right primer: CTCCAACCCGTCCTTCTGTA. Internal WT amplicon: 1761 bp. Deletion size: 1301 bp. Deletion left flank: TTATATCATGTTTAGCCCACAAATATTCTA. Deletion right flank: TTTCCGGATGGAACATATTATGATAGAACT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060431 added based on AFP_Strain data." | WBGene00003658(nhr-68) | WBGene00003658(nhr-68) | WB-STRAIN:WBStrain00036665 | WormBase (WB) | WB | available | PMID:33016879 PMID:37043428 |
WB-STRAIN:VC1527, CGC_VC1527 | 2026-08-15 09:33:14 | 1 | ||
|
VC1531 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036668 | Caenorhabditis elegans | Y37D8A.2(gk704) III. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y37D8A.2. External left primer: TATTGGCCTTGAGAACACCC. External right primer: CTCTTCGTCAGTTTTTCGGC. Internal left primer: TTGAAAGCGCGAAACAATTT. Internal right primer: CTTCAGGCTTCTGGCAAACT. Internal WT amplicon: 1789 bp. Deletion size: 306 bp. Deletion left flank: ATGATTTTTTGAAAATTAAAAAAAAACCAG. Deletion right flank: TTTTGCCTTTTTCTTCAAAATCCAAGCAAA. Insertion Sequence: CC." | WBGene00012544(Y37D8A.2) | WBGene00012544(Y37D8A.2) | WB-STRAIN:WBStrain00036668 | WormBase (WB) | WB | available | WB-STRAIN:VC1531, CGC_VC1531 | 2026-08-15 09:33:14 | 0 | |||
|
VC1530 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00036667 | Caenorhabditis elegans | mei-1(ok2000) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Supplementary_genotype mei-1 (ok2000) I / hT2[bli-4(e937) let-7(q782) qIs48 (I;III)|"T01G9.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2000 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATTGTTTGTCGCGGATGA. External right primer: GATGAAGGTGGCCTTGAAAA. Internal left primer: TGTTTCCAACAAGTGAGCCA. Internal right primer: CAAAAACCAAAGCTAGGCCA. Internal WT amplicon: 2180 bp. Deletion size: 1378 bp. Deletion left flank: ACAAAGAAAGGAGTTGGAGCAGCAGGTCCA. Deletion right flank: CAAAGAATGGTGTGACTCTTTTGGTGCCAT. Insertion Sequence: TGTAAATCAACTATTTATTGTGATCTCCTTTTAGTTTAAAATATTGTGGCCTAGCTTTG GGTTTTTGAAA."|"T01G9.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2000 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATTGTTTGTCGCGGATGA. External right primer: GATGAAGGTGGCCTTGAAAA. Internal left primer: TGTTTCCAACAAGTGAGCCA. Internal right primer: CAAAAACCAAAGCTAGGCCA. Internal WT amplicon: 2180 bp. Deletion size: 1378 bp. Deletion left flank: ACAAAGAAAGGAGTTGGAGCAGCAGGTCCA. Deletion right flank: CAAAGAATGGTGTGACTCTTTTGGTGCCAT. Insertion Sequence: TGTAAATCAACTATTTATTGTGATCTCCTTTTAGTTTAAAATATTGTGGCCTAGCTTTGGGTTTTTGAAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00003183(mei-1) | WBGene00000254(bli-4), WBGene00003183(mei-1) | WB-STRAIN:WBStrain00036667 | WormBase (WB) | WB | available | PMID:37603562 | WB-STRAIN:VC1530, CGC_VC1530 | 2026-08-15 09:33:14 | 2 | ||
|
VC1569 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036700 | Caenorhabditis elegans | bbs-2(ok2053) IV. | F20D12.3. Superficially wild type. External left primer: ATGGTCCGTGAATCCAATGT. External right primer: CTCAACTGAGCAGCTTGTCG. Internal left primer: CCATGGCAACATGTAAGCAC. Internal right primer: CTGCAGCATCGTTAGCTTTG. Internal WT amplicon: 3305 bp. Deletion size: 2306 bp. Deletion left flank: AACGGATGAAATAACATGTTTGGCTCATGT. Deletion right flank: GTGAAAGAGATTATCATTCGTGCTGAAGAT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000242(bbs-2) | WBGene00000242(bbs-2) | WB-STRAIN:WBStrain00036700 | WormBase (WB) | WB | available | PMID:38302462 | WB-STRAIN:VC1569, CGC_VC1569 | 2026-08-15 09:33:14 | 0 | ||
|
VC1533 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036670 | Caenorhabditis elegans | T23D8.3(ok2016) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | T23D8.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2016 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGAAGAGCAAGAAGGCGA. External right primer: GGCGCCAATACTTGTTGAAT. Internal left primer: ACACAATTGAGTCGAAGGGG. Internal right primer: CCGGTTCTGTCCAATCAGTT. Internal WT amplicon: 3212 bp. Deletion size: 1434 bp. Deletion left flank: AGGGAATATAAGGAATATTTTGAGACGGGT. Deletion right flank: ATAATTTTCTTGAAGTTTATTTTTCATAAA. Insertion Sequence: ATAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00011944(T23D8.3) | WBGene00000254(bli-4), WBGene00011944(T23D8.3) | WB-STRAIN:WBStrain00036670 | WormBase (WB) | WB | available | WB-STRAIN:VC1533, CGC_VC1533 | 2026-08-15 09:33:14 | 0 | |||
|
VC1494 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036637 | Caenorhabditis elegans | npp-5(ok1966) II. | F07A11.3. Superficially wild type. External left primer: TCACGTGAAACCCACAGAAA. External right primer: CTTCCAACTCCTTCGACGAC. Internal left primer: TGTCTGTGAAAGATCGACCG. Internal right primer: CGATATTCCTCAAGGGCAAA. Internal WT amplicon: 2771 bp. Deletion size: 1291 bp. Deletion left flank: AGCCCAAGTTTCAGAGCAATAGTGATCATG. Deletion right flank: TGTCATCTGGTAGTACTTTGCGCGTCGAGA.|"Made_by: Ola Rogula"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003791(npp-5) | WBGene00003791(npp-5) | WB-STRAIN:WBStrain00036637 | WormBase (WB) | WB | available | WB-STRAIN:VC1494, CGC_VC1494 | 2026-08-15 09:33:13 | 0 | |||
|
VC1484 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036631 | Caenorhabditis elegans | K09B11.2(ok1967) IV/nT1 [qIs51] (IV;V). | K09B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1967 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAACTAACGGCTTTGC. External right primer: TTGCTCGATTCACACGAAAC. Internal left primer: TGGAGGAATTGTTGCAGTGA. Internal right primer: CCGGAAGGTTGTAGTCGTTG. Internal WT amplicon: 4083 bp. Deletion size: 1709. Deletion left flank: TTAGCTGGAGCGAATAACGATCGGAAAGTT. Deletion right flank: AAATATAACATTTTACAGTTTTCGTTTCAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010709(nol-9) | WBGene00010709(nol-9) | WB-STRAIN:WBStrain00036631 | WormBase (WB) | WB | available | WB-STRAIN:VC1484, CGC_VC1484 | 2026-08-15 09:33:13 | 0 | |||
|
VC1485 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036632 | Caenorhabditis elegans | odc-1(ok1969) V/nT1 [qIs51] (IV;V). | K11C4.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1969 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTTTTGATCCACTCGTGA. External right primer: CGCTACACCACATCATCACC. Internal left primer: TTTCATTCTTCATGGAGCCC. Internal right primer: CTCTCCAAAGTTGACTCCGC. Internal WT amplicon: 2148 bp. Deletion size: 1529 bp. Deletion left flank: CTCCCACATTTCCTCGCTCATCACATACAT. Deletion right flank: TGTAAGATCAAAACGCTGCTAGCAAACTCT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003844(odc-1) | WBGene00003844(odc-1) | WB-STRAIN:WBStrain00036632 | WormBase (WB) | WB | available | WB-STRAIN:VC1485, CGC_VC1485 | 2026-08-15 09:33:13 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
