Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 90 showing 1781 ~ 1800 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00036566

http://www.wormbase.org/db/get?name=WBStrain00036566

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00002218(klp-6)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00002218(klp-6)
Availability: available
Source References: EMPTY
Synonyms: +/mT1 II; klp-6(ok1869)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC1396, CGC_VC1396
Notes: Mutagen:UV/TMP|"R144.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1869 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGCCAGATGAGGAAACAACA. External right primer: CTCAGGTGACACCAAAACGA. Internal left primer: TCGAAGATCTTGGCAGAGGT. Internal right primer: ACATACCCCAACTCAGTGGC. Internal WT amplicon: 3130 bp. Deletion size: 1991 bp. Deletion left flank: ATCGAGAAGGCTGTGTATGTGTGTCAACTT. Deletion right flank: AACAGAACGAGCTCTTCGTGAACTCCGAGA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036566 Copy   


  • RRID:WB-STRAIN:WBStrain00036601

http://www.wormbase.org/db/get?name=WBStrain00036601

Source Database: WormBase (WB)
Affected Genes: WBGene00001691(grd-2)
Genomic Alteration: WBGene00001691(grd-2)
Availability: available
Source References: EMPTY
Synonyms: grd-2(ok1902) V.
Alternate IDs: WB-STRAIN:VC1442, CGC_VC1442
Notes: F46B3.5. Superficially wild type. [NOTE: This strain apparently carries a patrially penetrant or heterozygous Rol in the background. It is present in the original stock received at the CGC.] External left primer: TGTCGAGTGCACAAGAAAGG. External right primer: CCGCAAAGTTTCTTAGCCTG. Internal left primer: CCGTGCAGGTAACCATCTTT. Internal right primer: TCCATGATCAAAACACACCG. Internal WT amplicon: 3162 bp. Deletion size: 1293 bp. Deletion left flank: GATTTTGCTTCCAGTATCCAATTCATCAAC. Deletion right flank: ATGTTGGCCTCCTGTTATAGTGAAGTTCAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036601 Copy   


  • RRID:WB-STRAIN:WBStrain00036571

http://www.wormbase.org/db/get?name=WBStrain00036571

Source Database: WormBase (WB)
Affected Genes: WBGene00003182(mef-2)
Genomic Alteration: WBGene00003182(mef-2)
Availability: available
Source References: EMPTY
Synonyms: mef-2(gk633) I.
Alternate IDs: WB-STRAIN:VC1402, CGC_VC1402
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W10D5.1. External left primer: CCCTGTTGGATCTCCTGAAA. External right primer: TCATCACACAACACACCACG. Internal left primer: AAGAAGGCAGGCTCGTGTAA. Internal right primer: CCACCTACTCCATACCGCAA. Internal WT amplicon: 1885 bp. Deletion size: 1075 bp. Deletion left flank: TATGAAAAATCATGGTAACCTCCAGAGATT. Deletion right flank: TAATTTTTATCAAAAAATTGTCAGAACATT."

Proper citation: RRID:WB-STRAIN:WBStrain00036571 Copy   


  • RRID:WB-STRAIN:WBStrain00036651

http://www.wormbase.org/db/get?name=WBStrain00036651

Source Database: WormBase (WB)
Affected Genes: WBGene00020591(nhr-220)
Genomic Alteration: WBGene00020591(nhr-220)
Availability: available
Source References: EMPTY
Synonyms: nhr-220(gk690) V.
Alternate IDs: WB-STRAIN:VC1509, CGC_VC1509
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T19H12.8. External left primer: CCTGGATTCGATTTTCGGTA. External right primer: GGCATCAGAAATGCTCCAAT. Internal left primer: AATAATGGCATCGGTTCTGG. Internal right primer: TCCAACCAAATGAGAGTCCC. Internal WT amplicon: 2272 bp. Deletion size: 672 bp. Deletion left flank: CCATTGGGGAAATTGCTTCAAACCCCGCAT. Deletion right flank: TTGTATTTTTTTCTCAAAGGTCTATAATTT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036651 Copy   


  • RRID:WB-STRAIN:WBStrain00036650

http://www.wormbase.org/db/get?name=WBStrain00036650

Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00018283(sulp-3)
Genomic Alteration: WBGene00003056(lon-2), WBGene00018283(sulp-3)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; sulp-3(ok1953)/szT1 X.
Alternate IDs: WB-STRAIN:VC1508, CGC_VC1508
Notes: F41D9.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1953 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTCGTAAGGGTAATTGGCA. External right primer: TCCAAGAAGGAGTGGTCCAG. Internal left primer: TTCATCAACAGCAGTTTGGC. Internal right primer: CAACGTGCATATCCCAACAG. Internal WT amplicon: 3086 bp. Deletion size: 2464 bp. Deletion left flank: GTTTCTGACATGACCTCTTCAGAATTTTCA. Deletion right flank: GAGGAAATCTGTTGATTAAATAATGAGTCA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036650 Copy   


  • RRID:WB-STRAIN:WBStrain00036652

http://www.wormbase.org/db/get?name=WBStrain00036652

Source Database: WormBase (WB)
Affected Genes: WBGene00009347(F32H5.1)
Genomic Alteration: WBGene00009347(F32H5.1)
Availability: available
Source References: EMPTY
Synonyms: F32H5.1(ok2017) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1511, CGC_VC1511
Notes: F32H5.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2017 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTGACAGAGACTTCGG. External right primer: GAGTTCGCGGAAATTTATGG. Internal left primer: CTAGACGGCGATACCTGGAA. Internal right primer: TTTCCAACATCCCTGGAGAG. Internal WT amplicon: 2266 bp. Deletion size: 1489 bp. Deletion left flank: ATCGTAAGAAATCATACCATTCTCTCCAAA. Deletion right flank: GTTTCCGCTTTCCATAGTTTCTGTTTTTTG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036652 Copy   


  • RRID:WB-STRAIN:WBStrain00036654

http://www.wormbase.org/db/get?name=WBStrain00036654

Source Database: WormBase (WB)
Affected Genes: WBGene00000082(adt-1)|WBGene00003056(lon-2)
Genomic Alteration: WBGene00000082(adt-1), WBGene00003056(lon-2)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; adt-1(ok1965)/szT1 X.
Alternate IDs: WB-STRAIN:VC1513, CGC_VC1513
Notes: C02B4.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1965 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATACGACGACCTCAGTTGCC. External right primer: GCACAACTTTTGTCGGGTTT. Internal left primer: GTGTGACCCGTTATTCGCTT. Internal right primer: GCTCAGGACAACTTGCTTCC. Internal WT amplicon: 3370 bp. Deletion size: 1659 bp. Deletion left flank: TGATGCTTCCCCAGGCCTTATATCTACAAA. Deletion right flank: ATGGGGCGATTGGCTGCCGTGCTCTGTATC. Insertion Sequence: A.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036654 Copy   


  • RRID:WB-STRAIN:WBStrain00036656

http://www.wormbase.org/db/get?name=WBStrain00036656

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Y58G8A(gk1021) V.
Alternate IDs: WB-STRAIN:VC1516, CGC_VC1516
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y58G8A. External left primer: GGGCCAGTTGGTCAGAGATA. External right primer: GGGAAGTGATTCGTTCTCCA. Internal left primer: TGCACTCAAGATCAAACGGA. Internal right primer: CTAGACTGGGCGGCATTTAG. Internal WT amplicon: 2306 bp. Deletion size: 125 bp. Deletion left flank: ATTCAACAAGGGAAATGGGGGCTGGGTAAA. Deletion right flank: CTTTGAAGAGACACAGGTGTGAGTTTGCGG."

Proper citation: RRID:WB-STRAIN:WBStrain00036656 Copy   


  • RRID:WB-STRAIN:WBStrain00036660

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00036660

Source Database: WormBase (WB)
Affected Genes: WBGene00003720(nhr-130)
Genomic Alteration: WBGene00003720(nhr-130)
Availability: available
Source References: EMPTY
Synonyms: nhr-130(gk710) V.
Alternate IDs: WB-STRAIN:VC1520, CGC_VC1520
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T01G6.8. External left primer: TTCGGATACTTTTCGGTTGC. External right primer: TTCCATTTTTACGGTCCTCG. Internal left primer: GATATGAGGTCCCGATCGAA. Internal right primer: TGAGGCAGATTGGTGTTCTG. Internal WT amplicon: 2444 bp. Deletion size: 1218 bp. Deletion left flank: TTTGAAGCTTCCGCAAAAATTTACATTCCC. Deletion right flank: AAAAAAAATACCGGAAAATAGGCTCCGCCC. Insertion Sequence: AAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036660 Copy   


  • RRID:WB-STRAIN:WBStrain00036669

http://www.wormbase.org/db/get?name=WBStrain00036669

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Y58G8A(gk1022) V.
Alternate IDs: WB-STRAIN:VC1532, CGC_VC1532
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y58G8A. External left primer: GGGCCAGTTGGTCAGAGATA. External right primer: GGGAAGTGATTCGTTCTCCA. Internal left primer: TGCACTCAAGATCAAACGGA. Internal right primer: CTAGACTGGGCGGCATTTAG. Internal WT amplicon: 2306 bp. Deletion size: 210 bp. Deletion left flank: TACATTCAACAAGGGAAATGGGGGCTGGGT. Deletion right flank: TGGGCGACAAACTATTTTTTTCCGGCAACA."

Proper citation: RRID:WB-STRAIN:WBStrain00036669 Copy   


  • RRID:WB-STRAIN:WBStrain00036663

http://www.wormbase.org/db/get?name=WBStrain00036663

Source Database: WormBase (WB)
Affected Genes: WBGene00003707(nhr-117)
Genomic Alteration: WBGene00003707(nhr-117)
Availability: available
Source References: EMPTY
Synonyms: nhr-117(gk691) V.
Alternate IDs: WB-STRAIN:VC1524, CGC_VC1524
Notes: F16B4.12. Superficially wild type. External left primer: CATACGGCAAGTTCAGCAAA. External right primer: CTACCAACCTGGTCATGGCT. Internal left primer: TCGGGATTTGACAAGTTCGT. Internal right primer: GCCGACTGTTGTCAGGATCT. Internal WT amplicon: 1781 bp. Deletion size: 1010 bp. Deletion left flank: TCACAAATCACCTCATCGTAAAACATTTCA. Deletion right flank: CGAGTGCTAAAAGCGGGCTCCGCGCAGACT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036663 Copy   


  • RRID:WB-STRAIN:WBStrain00036666

http://www.wormbase.org/db/get?name=WBStrain00036666

Source Database: WormBase (WB)
Affected Genes: WBGene00006744(unc-4)
Genomic Alteration: WBGene00006744(unc-4)
Availability: available
Source References: EMPTY
Synonyms: unc-4(gk705) II.
Alternate IDs: WB-STRAIN:VC1528, CGC_VC1528
Notes: F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 307 bp. Deletion left flank: TGCAAAGTATTTCACTACAGTTTTACTGTA. Deletion right flank: GCTTAATCCTGCTAGACTTCTACCACAAAA.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036666 Copy   


  • RRID:WB-STRAIN:WBStrain00036665

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00036665

Source Database: WormBase (WB)
Affected Genes: WBGene00003658(nhr-68)
Genomic Alteration: WBGene00003658(nhr-68)
Availability: available
Source References: PMID:33016879, PMID:37043428
Synonyms: nhr-68(gk708) V.
Alternate IDs: WB-STRAIN:VC1527, CGC_VC1527
Notes: H12C20.3. External left primer: CGGTTCTAATCCTCCGTCAA. External right primer: AGCGCACCTGTAAATTGCTT. Internal left primer: TGCCTTGTTTGCCAAGATTT. Internal right primer: CTCCAACCCGTCCTTCTGTA. Internal WT amplicon: 1761 bp. Deletion size: 1301 bp. Deletion left flank: TTATATCATGTTTAGCCCACAAATATTCTA. Deletion right flank: TTTCCGGATGGAACATATTATGATAGAACT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060431 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00036665 Copy   


  • RRID:WB-STRAIN:WBStrain00036668

http://www.wormbase.org/db/get?name=WBStrain00036668

Source Database: WormBase (WB)
Affected Genes: WBGene00012544(Y37D8A.2)
Genomic Alteration: WBGene00012544(Y37D8A.2)
Availability: available
Source References: EMPTY
Synonyms: Y37D8A.2(gk704) III.
Alternate IDs: WB-STRAIN:VC1531, CGC_VC1531
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y37D8A.2. External left primer: TATTGGCCTTGAGAACACCC. External right primer: CTCTTCGTCAGTTTTTCGGC. Internal left primer: TTGAAAGCGCGAAACAATTT. Internal right primer: CTTCAGGCTTCTGGCAAACT. Internal WT amplicon: 1789 bp. Deletion size: 306 bp. Deletion left flank: ATGATTTTTTGAAAATTAAAAAAAAACCAG. Deletion right flank: TTTTGCCTTTTTCTTCAAAATCCAAGCAAA. Insertion Sequence: CC."

Proper citation: RRID:WB-STRAIN:WBStrain00036668 Copy   


  • RRID:WB-STRAIN:WBStrain00036667

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00036667

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003183(mei-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003183(mei-1)
Availability: available
Source References: PMID:37603562
Synonyms: mei-1(ok2000) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1530, CGC_VC1530
Notes: Supplementary_genotype mei-1 (ok2000) I / hT2[bli-4(e937) let-7(q782) qIs48 (I;III)|"T01G9.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2000 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATTGTTTGTCGCGGATGA. External right primer: GATGAAGGTGGCCTTGAAAA. Internal left primer: TGTTTCCAACAAGTGAGCCA. Internal right primer: CAAAAACCAAAGCTAGGCCA. Internal WT amplicon: 2180 bp. Deletion size: 1378 bp. Deletion left flank: ACAAAGAAAGGAGTTGGAGCAGCAGGTCCA. Deletion right flank: CAAAGAATGGTGTGACTCTTTTGGTGCCAT. Insertion Sequence: TGTAAATCAACTATTTATTGTGATCTCCTTTTAGTTTAAAATATTGTGGCCTAGCTTTG GGTTTTTGAAA."|"T01G9.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2000 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATTGTTTGTCGCGGATGA. External right primer: GATGAAGGTGGCCTTGAAAA. Internal left primer: TGTTTCCAACAAGTGAGCCA. Internal right primer: CAAAAACCAAAGCTAGGCCA. Internal WT amplicon: 2180 bp. Deletion size: 1378 bp. Deletion left flank: ACAAAGAAAGGAGTTGGAGCAGCAGGTCCA. Deletion right flank: CAAAGAATGGTGTGACTCTTTTGGTGCCAT. Insertion Sequence: TGTAAATCAACTATTTATTGTGATCTCCTTTTAGTTTAAAATATTGTGGCCTAGCTTTGGGTTTTTGAAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036667 Copy   


  • RRID:WB-STRAIN:WBStrain00036700

http://www.wormbase.org/db/get?name=WBStrain00036700

Source Database: WormBase (WB)
Affected Genes: WBGene00000242(bbs-2)
Genomic Alteration: WBGene00000242(bbs-2)
Availability: available
Source References: PMID:38302462
Synonyms: bbs-2(ok2053) IV.
Alternate IDs: WB-STRAIN:VC1569, CGC_VC1569
Notes: F20D12.3. Superficially wild type. External left primer: ATGGTCCGTGAATCCAATGT. External right primer: CTCAACTGAGCAGCTTGTCG. Internal left primer: CCATGGCAACATGTAAGCAC. Internal right primer: CTGCAGCATCGTTAGCTTTG. Internal WT amplicon: 3305 bp. Deletion size: 2306 bp. Deletion left flank: AACGGATGAAATAACATGTTTGGCTCATGT. Deletion right flank: GTGAAAGAGATTATCATTCGTGCTGAAGAT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036700 Copy   


  • RRID:WB-STRAIN:WBStrain00036670

http://www.wormbase.org/db/get?name=WBStrain00036670

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00011944(T23D8.3)
Genomic Alteration: WBGene00000254(bli-4), WBGene00011944(T23D8.3)
Availability: available
Source References: EMPTY
Synonyms: T23D8.3(ok2016) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1533, CGC_VC1533
Notes: T23D8.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2016 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGAAGAGCAAGAAGGCGA. External right primer: GGCGCCAATACTTGTTGAAT. Internal left primer: ACACAATTGAGTCGAAGGGG. Internal right primer: CCGGTTCTGTCCAATCAGTT. Internal WT amplicon: 3212 bp. Deletion size: 1434 bp. Deletion left flank: AGGGAATATAAGGAATATTTTGAGACGGGT. Deletion right flank: ATAATTTTCTTGAAGTTTATTTTTCATAAA. Insertion Sequence: ATAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036670 Copy   


  • RRID:WB-STRAIN:WBStrain00036637

http://www.wormbase.org/db/get?name=WBStrain00036637

Source Database: WormBase (WB)
Affected Genes: WBGene00003791(npp-5)
Genomic Alteration: WBGene00003791(npp-5)
Availability: available
Source References: EMPTY
Synonyms: npp-5(ok1966) II.
Alternate IDs: WB-STRAIN:VC1494, CGC_VC1494
Notes: F07A11.3. Superficially wild type. External left primer: TCACGTGAAACCCACAGAAA. External right primer: CTTCCAACTCCTTCGACGAC. Internal left primer: TGTCTGTGAAAGATCGACCG. Internal right primer: CGATATTCCTCAAGGGCAAA. Internal WT amplicon: 2771 bp. Deletion size: 1291 bp. Deletion left flank: AGCCCAAGTTTCAGAGCAATAGTGATCATG. Deletion right flank: TGTCATCTGGTAGTACTTTGCGCGTCGAGA.|"Made_by: Ola Rogula"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036637 Copy   


  • RRID:WB-STRAIN:WBStrain00036631

http://www.wormbase.org/db/get?name=WBStrain00036631

Source Database: WormBase (WB)
Affected Genes: WBGene00010709(nol-9)
Genomic Alteration: WBGene00010709(nol-9)
Availability: available
Source References: EMPTY
Synonyms: K09B11.2(ok1967) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1484, CGC_VC1484
Notes: K09B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1967 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAACTAACGGCTTTGC. External right primer: TTGCTCGATTCACACGAAAC. Internal left primer: TGGAGGAATTGTTGCAGTGA. Internal right primer: CCGGAAGGTTGTAGTCGTTG. Internal WT amplicon: 4083 bp. Deletion size: 1709. Deletion left flank: TTAGCTGGAGCGAATAACGATCGGAAAGTT. Deletion right flank: AAATATAACATTTTACAGTTTTCGTTTCAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036631 Copy   


  • RRID:WB-STRAIN:WBStrain00036632

http://www.wormbase.org/db/get?name=WBStrain00036632

Source Database: WormBase (WB)
Affected Genes: WBGene00003844(odc-1)
Genomic Alteration: WBGene00003844(odc-1)
Availability: available
Source References: EMPTY
Synonyms: odc-1(ok1969) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1485, CGC_VC1485
Notes: K11C4.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1969 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTTTTGATCCACTCGTGA. External right primer: CGCTACACCACATCATCACC. Internal left primer: TTTCATTCTTCATGGAGCCC. Internal right primer: CTCTCCAAAGTTGACTCCGC. Internal WT amplicon: 2148 bp. Deletion size: 1529 bp. Deletion left flank: CTCCCACATTTCCTCGCTCATCACATACAT. Deletion right flank: TGTAAGATCAAAACGCTGCTAGCAAACTCT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036632 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X