Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00030671
Source Database: WormBase (WB)
Affected Genes: WBGene00001995(hpl-1)
Genomic Alteration: WBGene00001995(hpl-1)
Availability: available
Source References: EMPTY
Synonyms: hpl-1(tm1624) X.
Alternate IDs: WB-STRAIN:PFR60, CGC_PFR60
Notes: Wild type phenotype.
Proper citation: RRID:WB-STRAIN:WBStrain00030671 Copy
http://www.wormbase.org/db/get?name=WBStrain00030609
Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)
Genomic Alteration: WBGene00004879(smg-1)
Availability: available
Source References: PMID:31882874, PMID:32302543, PMID:37728486, PMID:37936921
Synonyms: smg-1(cc546) I.
Alternate IDs: WB-STRAIN:PD8120, CGC_PD8120
Notes: Made_by: Getz and Fire|"Reference WBPaper00058995 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype smg-1(cc546)"|"Supplementary_genotype smg-1(cc546) I"|"Temperature sensitive. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]"|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030609 Copy
http://www.wormbase.org/db/get?name=WBStrain00030634
Source Database: WormBase (WB)
Availability: available
Source References: PMID:32687264, PMID:33188857, PMID:38594249, PMID:39519157
Synonyms: feIs5 X.
Alternate IDs: WB-STRAIN:PE255, CGC_PE255
Notes: feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.|"WBStrain mapped, WBPaper00059997 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030634 Copy
http://www.wormbase.org/db/get?name=WBStrain00030632
Source Database: WormBase (WB)
Affected Genes: WBGene00000894(dab-1)
Genomic Alteration: WBGene00000894(dab-1)
Availability: available
Source References: EMPTY
Synonyms: dab-1(gk291) II; feEx43.
Alternate IDs: WB-STRAIN:PE219, CGC_PE219
Notes: feEx43 [dab-1::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Holmes et al. J Cell Sci. 2007 Aug 1;120(Pt 15):2741-51.
Proper citation: RRID:WB-STRAIN:WBStrain00030632 Copy
http://www.wormbase.org/db/get?name=WBStrain00030794
Source Database: WormBase (WB)
Affected Genes: WBGene00003884(osm-3)
Genomic Alteration: WBGene00003884(osm-3)
Availability: available
Source References: PMID:32916106, PMID:37463209, PMID:38302462, PMID:38421867
Synonyms: osm-3(p802) IV.
Alternate IDs: WB-STRAIN:PR802, CGC_PR802
Notes: Fails to avoid high osmotic strength solutions of NaCl and fructose. Fails to stain amphids with FITC.|"WBStrain mapped, WBPaper00060242 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030794 Copy
http://www.wormbase.org/db/get?name=WBStrain00030792
Source Database: WormBase (WB)
Affected Genes: WBGene00006652(ttx-1)
Genomic Alteration: WBGene00006652(ttx-1)
Availability: available
Source References: PMID:7630402, PMID:33759761, PMID:34533135, PMID:37572357, PMID:37769660, PMID:38421867
Synonyms: ttx-1(p767) V
Alternate IDs: WB-STRAIN:PR767, CGC_PR767
Notes: Made_by:|"Supplementary_genotype -AFD: ttx-1(p767)"|"WBStrain provided so WBPaper00061198 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030792 Copy
http://www.wormbase.org/db/get?name=WBStrain00030790
Source Database: WormBase (WB)
Affected Genes: WBGene00006525(tax-2)
Genomic Alteration: WBGene00006525(tax-2)
Availability: available
Source References: WBPaper00000119(PMID:EMPTY)
Synonyms: tax-2(p694) I.
Alternate IDs: WB-STRAIN:PR694, CGC_PR694
Notes: Defective in chemotaxis to everything except pyridine. Thermotaxis is weak.|"Made_by: Sheridan R"|"WBStrain provided so WBPaper00061436 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030790 Copy
http://www.wormbase.org/db/get?name=WBStrain00030796
Source Database: WormBase (WB)
Affected Genes: WBGene00003886(osm-6)
Genomic Alteration: WBGene00003886(osm-6)
Availability: available
Source References: PMID:31797327, PMID:33759761, PMID:34517863, PMID:38177330, PMID:38302462, PMID:38421867
Synonyms: osm-6(p811) V.
Alternate IDs: WB-STRAIN:PR811, CGC_PR811
Notes: Fails to avoid high osmotic strength solutions of NaCl and fructose. Fails to stain amphids with FITC.|"WBStrain provided so WBPaper00061198 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061917 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030796 Copy
http://www.wormbase.org/db/get?name=WBStrain00030775
Source Database: WormBase (WB)
Affected Genes: WBGene00000105(alg-1)
Genomic Alteration: WBGene00000105(alg-1)
Availability: available
Source References: PMID:38594249
Synonyms: alg-1(ap423[3xflag::gfp::alg-1]) X.
Alternate IDs: WB-STRAIN:PQ530, CGC_PQ530
Notes: alg-1(ap423 [3xflag::gfp::alg-1]) X. ALG-1 tagged at N-terminal with 3xFLAG:GFP at endogenous locus, verified by western blot and fluorescence microscopy. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.|"Made_by: James Broughton"
Proper citation: RRID:WB-STRAIN:WBStrain00030775 Copy
http://www.wormbase.org/db/get?name=WBStrain00030783
Source Database: WormBase (WB)
Affected Genes: WBGene00000483(che-1)
Genomic Alteration: WBGene00000483(che-1)
Availability: available
Source References: PMID:17246100, PMID:38446031
Synonyms: che-1(p674) I.
Alternate IDs: WB-STRAIN:PR674, CGC_PR674
Notes: Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Thermotaxis okay.|"Made_by: Dusenbery D"
Proper citation: RRID:WB-STRAIN:WBStrain00030783 Copy
http://www.wormbase.org/db/get?name=WBStrain00030782
Source Database: WormBase (WB)
Affected Genes: WBGene00000915(hsp-90)
Genomic Alteration: WBGene00000915(hsp-90)
Availability: available
Source References: WBPaper00000119(PMID:EMPTY)
Synonyms: hsp-90(p673) V.
Alternate IDs: WB-STRAIN:PR673, CGC_PR673
Notes: Defective in chemotaxis to all attractants and to D-tryptophan; partially defective in chemotaxis to CO2(phosphate) and H+(citrate). Thermotaxis weak. p673 previously called tax-3 or daf-21.|"Defective in chemotaxis to all attractants and to D-tryptophan; partially defective in chemotaxis to CO2(phosphate) and H+(citrate). Thermotaxis weak. p673 previously called tax-3."|"Made_by: Dusenbery D"
Proper citation: RRID:WB-STRAIN:WBStrain00030782 Copy
http://www.wormbase.org/db/get?name=WBStrain00030781
Source Database: WormBase (WB)
Affected Genes: WBGene00000483(che-1)
Genomic Alteration: WBGene00000483(che-1)
Availability: available
Source References: PMID:37258276, PMID:37591249, PMID:38302462, PMID:38446031
Synonyms: che-1(p672) I.
Alternate IDs: WB-STRAIN:PR672, CGC_PR672
Notes: Defective in chemotaxis to Na+, OH-, NaHCO3; partially defective in chemotaxis to CL-; inverted taxis to cAMP.|"Made_by: Dusenbery D"|"Supplementary_genotype che-1(p672)"
Proper citation: RRID:WB-STRAIN:WBStrain00030781 Copy
http://www.wormbase.org/db/get?name=WBStrain00030780
Source Database: WormBase (WB)
Affected Genes: WBGene00006525(tax-2)
Genomic Alteration: WBGene00006525(tax-2)
Availability: available
Source References: WBPaper00000119(PMID:EMPTY)
Synonyms: tax-2(p671) I.
Alternate IDs: WB-STRAIN:PR671, CGC_PR671
Notes: Defective in chemotaxis to Na+, Cl-, OH-, NaHCO3, pryidine, cAMP, D-tryptophan, CO2(phospate). Partially defective in chemotaxis to H+(phsophate). Slightly inverted taxis to H+(citrate). Thermotaxis defective too.|"Defective in chemotaxis to Na+, Cl-, OH-, NaHCO3, pyridine, cAMP, D-tryptophan, CO2(phosphate). Partially defective in chemotaxis to H+(phosphate). Slightly inverted taxis to H+(citrate). Thermotaxis defective too."|"Made_by: Dusenbery D"|"WBStrain provided so WBPaper00061436 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030780 Copy
http://www.wormbase.org/db/get?name=WBStrain00030788
Source Database: WormBase (WB)
Affected Genes: WBGene00006525(tax-2)
Genomic Alteration: WBGene00006525(tax-2)
Availability: available
Source References: PMID:33440164, PMID:33759761, PMID:34040027, PMID:36652499, PMID:37769660, PMID:38421867
Synonyms: tax-2(p691) I.
Alternate IDs: WB-STRAIN:PR691, CGC_PR691
Notes: Defective in chemotaxis to all attractants and to D-tryptophan. Thermotaxis defective.|"Made_by: Sheridan R"|"Supplementary_genotype tax-2(p691)"|"WBStrain mapped, WBPaper00060871 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061444 added based on AFP_Strain data."|"WBStrain provided so WBPaper00061198 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030788 Copy
http://www.wormbase.org/db/get?name=WBStrain00030787
Source Database: WormBase (WB)
Affected Genes: WBGene00000483(che-1)
Genomic Alteration: WBGene00000483(che-1)
Availability: available
Source References: PMID:730048, PMID:38446031
Synonyms: che-1(p680) I.
Alternate IDs: WB-STRAIN:PR680, CGC_PR680
Notes: Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Thermotaxis okay.|"Made_by: Dusenbery D"|"WBStrain mapped, WBPaper00061436 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030787 Copy
http://www.wormbase.org/db/get?name=WBStrain00030785
Source Database: WormBase (WB)
Affected Genes: WBGene00006526(tax-4)
Genomic Alteration: WBGene00006526(tax-4)
Availability: available
Source References: PMID:33759761, PMID:38396085, PMID:38935621, PMID:40485984
Synonyms: tax-4(p678) III.
Alternate IDs: WB-STRAIN:PR678, CGC_PR678
Notes: Defective in chemotaxis to Na+, NaHCO3, pyridine, cAMP, D-tryptophan; partially defective to CO2(phosphate)m H+(phosphate),, H+(citrate); inverted taxis to Cl-, OH-. Progeny yield about 50% of normal. No Thermotaxis. See also WBPaper00002585.|"Made_by: Dusenbery D"|"WBStrain provided so WBPaper00061198 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061436 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030785 Copy
http://www.wormbase.org/db/get?name=WBStrain00030769
Source Database: WormBase (WB)
Affected Genes: WBGene00006734(ufd-2)
Genomic Alteration: WBGene00006734(ufd-2)
Availability: available
Source References: PMID:37643243
Synonyms: ufd-2(tm1380) II.
Alternate IDs: WB-STRAIN:PP198, CGC_PP198
Notes: Supplementary_genotype ufd-2(tm1380)
Proper citation: RRID:WB-STRAIN:WBStrain00030769 Copy
http://www.wormbase.org/db/get?name=WBStrain00030766
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00004208(ptc-1)|WBGene00006744(unc-4)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00004208(ptc-1), WBGene00006744(unc-4), WBGene00006787(unc-52)
Availability: available
Source References: EMPTY
Synonyms: ptc-1(ok122) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:PK172, CGC_PK172
Notes: Heterozygotes are WT and segregate WT, paralyzed Dpys, and Uncs which are sterile (with 1-2 escaper progeny). ptc-1 homozygotes have multinucleate germ cells (both sperm and oocytes). ptc-1 homozygotes have an underproliferated germline.|"Mutagen:UV/psoralen"|"Mutagen:UV/Psoralen"
Proper citation: RRID:WB-STRAIN:WBStrain00030766 Copy
http://www.wormbase.org/db/get?name=WBStrain00030893
Source Database: WormBase (WB)
Affected Genes: WBGene00000429(ceh-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000429(ceh-2), WBGene00006843(unc-119)
Availability: available
Source References: PMID:26024448
Synonyms: syIs54 II; unc-119(ed4) III.
Alternate IDs: WB-STRAIN:PS3504, CGC_PS3504
Notes: syIs54 [ceh-2::GFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00030893 Copy
http://www.wormbase.org/db/get?name=WBStrain00030816
Source Database: WormBase (WB)
Affected Genes: WBGene00006829(unc-101)
Genomic Alteration: WBGene00006829(unc-101)
Availability: available
Source References: PMID:8288128, PMID:37053235, PMID:38302462
Synonyms: unc-101(sy108) I.
Alternate IDs: WB-STRAIN:PS529, CGC_PS529
Notes: Made_by: Greg Jongeward|"Unc. Suppresses the Vul phenotypes of let-23(lf) mutants. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."
Proper citation: RRID:WB-STRAIN:WBStrain00030816 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.