Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
PS6936 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030987 | Caenorhabditis elegans | syIs321 I. | Made_by: Han Wang and Jonathan Liu|"syIs321 [myo-3p::NLS::GAL4SK::VP64::unc-54"|"syIs321 [myo-3p::NLS::GAL4SK::VP64::unc-543'UTR + myo-2p::NLS::mCherry + pBlueScript]. myo-3 cGAL driver for body wall muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." | WB-STRAIN:WBStrain00030987 | WormBase (WB) | WB | available | PMID:38869949 PMID:39738055 |
WB-STRAIN:PS6936, CGC_PS6936 | 2026-08-15 09:31:29 | 1 | ||||
|
PS6935 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030986 | Caenorhabditis elegans | syIs320 V. | Made_by: Han Wang and Jonathan Liu|"syIs320"|"syIs320[nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] V. nlp-40 cGAL driver for intestine. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." | WB-STRAIN:WBStrain00030986 | WormBase (WB) | WB | available | WB-STRAIN:PS6935, CGC_PS6935 | 2026-08-15 09:31:29 | 0 | |||||
|
PS6916 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030984 | Caenorhabditis elegans | syIs317 II. | Made_by: Han Wang and Jonathan Liu|"syIs317"|"syIs317 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript]. nlp-40 cGAL driver for intestine. NOTE: Incorrectly annotated as being on LG III in paper; actually should be on LG II.Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." | WB-STRAIN:WBStrain00030984 | WormBase (WB) | WB | available | PMID:39738055 | WB-STRAIN:PS6916, CGC_PS6916 | 2026-08-15 09:31:29 | 0 | ||||
|
PS3665 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030907 | Caenorhabditis elegans | syIs66 II; unc-119(ed4) III. | syIs66 [B0034.1::pes-10::GFP + unc-119(+)] II. Expressed in vulE and vulF. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00030907 | WormBase (WB) | WB | available | WB-STRAIN:PS3665, CGC_PS3665 | 2026-08-15 09:31:27 | 0 | |||
|
PS3663 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030905 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00000584(cog-1) | WBGene00000584(cog-1) | WB-STRAIN:WBStrain00030905 | WormBase (WB) | WB | unknown | WB-STRAIN:PS3663 | 2026-08-15 09:31:27 | 0 | |||
|
PS3662 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030904 | Caenorhabditis elegans | syIs63. | syIs63 [cog-1::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"syIs63[cog-1::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects." | WBGene00000584(cog-1) | WBGene00000584(cog-1) | WB-STRAIN:WBStrain00030904 | WormBase (WB) | WB | available | PMID:26024448 | WB-STRAIN:PS3662, CGC_PS3662 | 2026-08-15 09:31:27 | 0 | ||
|
PS3653 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030903 | Caenorhabditis elegans | ipp-5(sy605) X. | Subtle ovulation defect which is viewable by Nomarski - 2 oocytes ovulate (pass into uterus) at the same time. Double mutants with lfe-2(sy326) and lfe-1(sy290) show sterility. Double mutant with lin-3(n1058) is fertile. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. | WBGene00002146(ipp-5) | WBGene00002146(ipp-5) | WB-STRAIN:WBStrain00030903 | WormBase (WB) | WB | available | WB-STRAIN:PS3653, CGC_PS3653 | 2026-08-15 09:31:27 | 0 | |||
|
PS7169 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031002 | Caenorhabditis elegans | syIs337 syIs398 III. | Made_by: Han Wang and Jonathan Liu|"syIs337 [15xUAS::pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." | WB-STRAIN:WBStrain00031002 | WormBase (WB) | WB | available | WB-STRAIN:PS7169, CGC_PS7169 | 2026-08-15 09:31:29 | 0 | |||||
|
PTM317 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031089 | Caenorhabditis elegans | nurf-1(kah91)II/ oxTi924 II | N2 Background | WB-STRAIN:WBStrain00031089 | WormBase (WB) | WB | unknown | WB-STRAIN:PTM317 | 2026-08-15 09:31:31 | 0 | |||||
|
PTM288 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031086 | Caenorhabditis elegans | dpy-10 (kah83)II kyIR1(V, CB4856>N2) qgIR1(X, CB4856>N2). | Information on this strain can be found in the following publication : https://www.biorxiv.org/content/early/2018/04/30/309997 | WB-STRAIN:WBStrain00031086 | WormBase (WB) | WB | unknown | WB-STRAIN:PTM288 | 2026-08-15 09:31:31 | 0 | |||||
|
PTM229 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031085 | Caenorhabditis elegans | dpy-10 (kah82)II. | Information on this strain can be found in the following publication : https://www.biorxiv.org/content/early/2018/04/30/309997 | WB-STRAIN:WBStrain00031085 | WormBase (WB) | WB | unknown | PMID:38771761 | WB-STRAIN:PTM229 | 2026-08-15 09:31:31 | 1 | ||||
|
PTM211 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031084 | Caenorhabditis elegans | nurf-1(kah66,kah73)II | N2 Background | WB-STRAIN:WBStrain00031084 | WormBase (WB) | WB | unknown | WB-STRAIN:PTM211 | 2026-08-15 09:31:31 | 0 | |||||
|
PS7199 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031009 | Caenorhabditis elegans | syIs371 III. | Made_by: Han Wang and Jonathan Liu|"syIs371"|"syIs371[15xUAS::pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)]. Histamine chloride channel cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." | WB-STRAIN:WBStrain00031009 | WormBase (WB) | WB | available | PMID:38096407 | WB-STRAIN:PS7199, CGC_PS7199 | 2026-08-15 09:31:29 | 0 | ||||
|
PS7190 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031007 | Caenorhabditis elegans | syIs409 X. | Made_by: Han Wang and Jonathan Liu|"syIs409"|"syIs409 [15xUAS::pes-10::mCherry::H2B::let-858 3'UTR + unc-122p::GFP + pBlueScript]. mCherry::H2B cGAL effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." | WB-STRAIN:WBStrain00031007 | WormBase (WB) | WB | available | WB-STRAIN:PS7190, CGC_PS7190 | 2026-08-15 09:31:29 | 0 | |||||
|
PS7185 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031005 | Caenorhabditis elegans | syIs406 IV. | Made_by: Han Wang and Jonathan Liu|"syIs406 [15xUAS::pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. GFP::H2B effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." | WB-STRAIN:WBStrain00031005 | WormBase (WB) | WB | available | WB-STRAIN:PS7185, CGC_PS7185 | 2026-08-15 09:31:29 | 0 | |||||
|
PTM332 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031093 | Caenorhabditis elegans | nurf-1(kah106) II/ oxTi924 II | N2 Background | WB-STRAIN:WBStrain00031093 | WormBase (WB) | WB | unknown | WB-STRAIN:PTM332 | 2026-08-15 09:31:31 | 0 | |||||
|
PTM325 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031092 | Caenorhabditis elegans | nurf-1(kah99)II/ oxTi924 II | N2 Background | WB-STRAIN:WBStrain00031092 | WormBase (WB) | WB | unknown | WB-STRAIN:PTM325 | 2026-08-15 09:31:31 | 0 | |||||
|
PTM322 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031091 | Caenorhabditis elegans | nurf-1(kah96)II/ oxTi924 II | N2 Background | WB-STRAIN:WBStrain00031091 | WormBase (WB) | WB | unknown | WB-STRAIN:PTM322 | 2026-08-15 09:31:31 | 0 | |||||
|
PS7731 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031014 | Caenorhabditis elegans | K03E5.2(sy1082) I. | Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2.Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGGReference: Wang H, et al. G3 (Bethesda)." | WBGene00019361(clik-3) | WBGene00019361(clik-3) | WB-STRAIN:WBStrain00031014 | WormBase (WB) | WB | available | PMID:30224336 | WB-STRAIN:PS7731, CGC_PS7731 | 2026-08-15 09:31:29 | 0 | ||
|
PS7778 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031018 | Caenorhabditis elegans | clik-1(sy1084) V. | Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagcReference: Wang H, et al. G3 (Bethesda)." | WBGene00020808(clik-1) | WBGene00020808(clik-1) | WB-STRAIN:WBStrain00031018 | WormBase (WB) | WB | available | PMID:30224336 | WB-STRAIN:PS7778, CGC_PS7778 | 2026-08-15 09:31:29 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
