Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 85 showing 1681 ~ 1700 out of 147,344 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00033339

http://www.wormbase.org/db/get?name=WBStrain00033339

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005053(sra-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005053(sra-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-27(ve512[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3012, CGC_RG3012
Notes: Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-27. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ctcttagtattattattatttgttccccct Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT"

Proper citation: RRID:WB-STRAIN:WBStrain00033339 Copy   


  • RRID:WB-STRAIN:WBStrain00033330

http://www.wormbase.org/db/get?name=WBStrain00033330

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005060(sra-34)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005060(sra-34), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-34(ve500[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3000, CGC_RG3000
Notes: Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-34. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: GAATTAATACAAACAACAGGAGCTGGAACA Right flanking sequence: gaaggtattgaataaaacgcggaagttcta"

Proper citation: RRID:WB-STRAIN:WBStrain00033330 Copy   


  • RRID:WB-STRAIN:WBStrain00033334

http://www.wormbase.org/db/get?name=WBStrain00033334

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005030(sra-4)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005030(sra-4), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-4(ve504[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3004, CGC_RG3004
Notes: Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-4. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ggtgtgaaagattttaaataaacaccctcg Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc"

Proper citation: RRID:WB-STRAIN:WBStrain00033334 Copy   


  • RRID:WB-STRAIN:WBStrain00033335

http://www.wormbase.org/db/get?name=WBStrain00033335

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005057(sra-31)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005057(sra-31), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-31(ve506[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3006, CGC_RG3006
Notes: Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-31. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites."

Proper citation: RRID:WB-STRAIN:WBStrain00033335 Copy   


  • RRID:WB-STRAIN:WBStrain00033425

http://www.wormbase.org/db/get?name=WBStrain00033425

Source Database: WormBase (WB)
Affected Genes: WBGene00016539(madd-2)
Genomic Alteration: WBGene00016539(madd-2)
Availability: available
Source References: EMPTY
Synonyms: madd-2(tr103) V.
Alternate IDs: WB-STRAIN:RP828, CGC_RP828
Notes: Midline-oriented migration defects including muscle arm extension and HSN, AVM, and PVM axon guidance defects. Reference: Alexander M, et al. Dev Cell. 2010 Jun 15;18(6):961-72.

Proper citation: RRID:WB-STRAIN:WBStrain00033425 Copy   


  • RRID:WB-STRAIN:WBStrain00033426

http://www.wormbase.org/db/get?name=WBStrain00033426

Source Database: WormBase (WB)
Affected Genes: WBGene00016539(madd-2)
Genomic Alteration: WBGene00016539(madd-2)
Availability: available
Source References: EMPTY
Synonyms: madd-2(tr129) V.
Alternate IDs: WB-STRAIN:RP1416, CGC_RP1416
Notes: Midline-oriented migration defects including muscle arm extension and HSN, AVM, and PVM axon guidance defects. Reference: Alexander M, et al. Dev Cell. 2010 Jun 15;18(6):961-72.

Proper citation: RRID:WB-STRAIN:WBStrain00033426 Copy   


  • RRID:WB-STRAIN:WBStrain00033429

http://www.wormbase.org/db/get?name=WBStrain00033429

Source Database: WormBase (WB)
Affected Genes: WBGene00003225(mev-1)
Genomic Alteration: WBGene00003225(mev-1)
Availability: available
Source References: PMID:26108372
Synonyms: mev-1(tr357) III.
Alternate IDs: WB-STRAIN:RP2637, CGC_RP2637
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00033429 Copy   


  • RRID:WB-STRAIN:WBStrain00033420

http://www.wormbase.org/db/get?name=WBStrain00033420

Source Database: WormBase (WB)
Affected Genes: WBGene00001187(egl-19)
Genomic Alteration: WBGene00001187(egl-19)
Availability: available
Source References: EMPTY
Synonyms: egl-19(tr69) IV.
Alternate IDs: WB-STRAIN:RP582, CGC_RP582
Notes: Made_by: T Kwok/P Roy|"Nemadipine-A resistant."

Proper citation: RRID:WB-STRAIN:WBStrain00033420 Copy   


  • RRID:WB-STRAIN:WBStrain00033422

http://www.wormbase.org/db/get?name=WBStrain00033422

Source Database: WormBase (WB)
Affected Genes: WBGene00001187(egl-19)
Genomic Alteration: WBGene00001187(egl-19)
Availability: available
Source References: EMPTY
Synonyms: egl-19(tr71) IV.
Alternate IDs: WB-STRAIN:RP584, CGC_RP584
Notes: Made_by: Kwok/Turnbull/P Roy|"Nemadipine-A resistant."

Proper citation: RRID:WB-STRAIN:WBStrain00033422 Copy   


  • RRID:WB-STRAIN:WBStrain00033423

http://www.wormbase.org/db/get?name=WBStrain00033423

Source Database: WormBase (WB)
Affected Genes: WBGene00001187(egl-19)
Genomic Alteration: WBGene00001187(egl-19)
Availability: available
Source References: EMPTY
Synonyms: egl-19(tr72) IV.
Alternate IDs: WB-STRAIN:RP585, CGC_RP585
Notes: Made_by: T Kwok/P Roy|"Myotonic. Nemadipine-A resistant."

Proper citation: RRID:WB-STRAIN:WBStrain00033423 Copy   


  • RRID:WB-STRAIN:WBStrain00033430

http://www.wormbase.org/db/get?name=WBStrain00033430

Source Database: WormBase (WB)
Affected Genes: WBGene00003225(mev-1)
Genomic Alteration: WBGene00003225(mev-1)
Availability: available
Source References: PMID:26108372
Synonyms: mev-1(tr359) III.
Alternate IDs: WB-STRAIN:RP2639, CGC_RP2639
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00033430 Copy   


  • RRID:WB-STRAIN:WBStrain00033402

http://www.wormbase.org/db/get?name=WBStrain00033402

Source Database: WormBase (WB)
Affected Genes: WBGene00004921(snt-1)
Genomic Alteration: WBGene00004921(snt-1)
Availability: available
Source References: EMPTY
Synonyms: snt-1(md290) II; mdIs126; mdIs129.
Alternate IDs: WB-STRAIN:RM3054, CGC_RM3054
Notes: mdIs126 [snt-1p::snt-1(genomic; B-stop)::CFP]. mdIs129 [snt-1p::snt-1(genomic; A-stop)::YFP]. snt-1 mutation in genome is rescued by 2 integrated transgenes. snt-1(genomic; B-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6B; also referred to as snt-1(A only). snt-1(genomic; A-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6A; also referred to as snt-1(B only). Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.

Proper citation: RRID:WB-STRAIN:WBStrain00033402 Copy   


  • RRID:WB-STRAIN:WBStrain00033405

http://www.wormbase.org/db/get?name=WBStrain00033405

Source Database: WormBase (WB)
Affected Genes: WBGene00000501(cho-1)|WBGene00004010(pha-1)
Genomic Alteration: WBGene00000501(cho-1), WBGene00004010(pha-1)
Availability: available
Source References: EMPTY
Synonyms: pha-1(e2123) III; cho-1(tm373) IV; mdEx790.
Alternate IDs: WB-STRAIN:RM3218, CGC_RM3218
Notes: mdEx790 [cho-1p(7.6kb)::cho-1::GFP + pha-1(+) + pBluescript]. CHO-1 translational fusion driven by 7.6 kb cho-1 promoter rescues cho-1 mutant behaviors, including reduced initial thrashing rate, fatigue, and synthetic interactions with pmt-2. Strong fluorescence in nerve ring, and ventral and dorsal nerve cords. Structure of the transgene is shown in Figure 1 of Mullen et al., 2007.

Proper citation: RRID:WB-STRAIN:WBStrain00033405 Copy   


  • RRID:WB-STRAIN:WBStrain00033406

http://www.wormbase.org/db/get?name=WBStrain00033406

Source Database: WormBase (WB)
Affected Genes: WBGene00000501(cho-1)|WBGene00003842(oct-1)|WBGene00018037(chtl-1)
Genomic Alteration: WBGene00000501(cho-1), WBGene00003842(oct-1), WBGene00018037(chtl-1)
Availability: available
Source References: EMPTY
Synonyms: oct-1(gk354) I; cho-1(tm373) IV; chtl-1(ok1695) X.
Alternate IDs: WB-STRAIN:RM3248, CGC_RM3248
Notes: Approximately wild-type in appearance, growth, and movement. Reference: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.

Proper citation: RRID:WB-STRAIN:WBStrain00033406 Copy   


  • RRID:WB-STRAIN:WBStrain00033407

http://www.wormbase.org/db/get?name=WBStrain00033407

Source Database: WormBase (WB)
Affected Genes: WBGene00004921(snt-1)|WBGene00006777(unc-41)
Genomic Alteration: WBGene00004921(snt-1), WBGene00006777(unc-41)
Availability: available
Source References: EMPTY
Synonyms: snt-1(md290) II; unc-41(e268) V.
Alternate IDs: WB-STRAIN:RM3286, CGC_RM3286
Notes: Unc.

Proper citation: RRID:WB-STRAIN:WBStrain00033407 Copy   


  • RRID:WB-STRAIN:WBStrain00033408

http://www.wormbase.org/db/get?name=WBStrain00033408

Source Database: WormBase (WB)
Affected Genes: WBGene00004010(pha-1)
Genomic Alteration: WBGene00004010(pha-1)
Availability: available
Source References: PMID:34534446
Synonyms: pha-1 (e2123) III; mdEx865 [unc-17p::NLS::mCherry + pha-1(+)]
Alternate IDs: WB-STRAIN:RM3325, CGC_RM3325
Notes: mdEx865 [unc-17p::NLS::mCherry + pha-1(+)]. Transcriptional reporter. Nuclear localized mCherry in cholinergic neurons. Maintain at 20-25C to retain array. References: Grundahl K and Rand J, unpublished. Granato M, Schnabel H, and Schnabel R, 1994. Genesis of an organ: molecular analysis of the pha-1 gene. Development 120: 30053017.

Proper citation: RRID:WB-STRAIN:WBStrain00033408 Copy   


  • RRID:WB-STRAIN:WBStrain00033482

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00033482

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:39097626
Synonyms: unc-119(ed3) III; pwIs503.
Alternate IDs: WB-STRAIN:RT1315, CGC_RT1315
Notes: pwIs503 [vha-6p::mans::GFP + Cbr-unc-119(+)]. This strain expresses an intestine-specific GFP marker for the Golgi apparatus (a fragment of C. elegans alpha-mannosidase II (F58H1.1, first 82 aa including signal sequence/TM-anchor domain as in Rolls et al., 2002). This fusion protein is expressed under the control of the vha-6 promoter.

Proper citation: RRID:WB-STRAIN:WBStrain00033482 Copy   


  • RRID:WB-STRAIN:WBStrain00033485

http://www.wormbase.org/db/get?name=WBStrain00033485

Source Database: WormBase (WB)
Affected Genes: WBGene00002299(let-23)|WBGene00006745(unc-5)
Genomic Alteration: WBGene00002299(let-23), WBGene00006745(unc-5)
Availability: available
Source References: EMPTY
Synonyms: let-23(n1045) II; unc-5(e53) IV.
Alternate IDs: WB-STRAIN:RU51, CGC_RU51
Notes: Unc and Vul.

Proper citation: RRID:WB-STRAIN:WBStrain00033485 Copy   


  • RRID:WB-STRAIN:WBStrain00033486

http://www.wormbase.org/db/get?name=WBStrain00033486

Source Database: WormBase (WB)
Affected Genes: WBGene00006699(uba-1)
Genomic Alteration: WBGene00006699(uba-1)
Availability: available
Source References: PMID:32857970, PMID:37980357
Synonyms: uba-1(it129) IV.
Alternate IDs: WB-STRAIN:RV110, CGC_RV110
Notes: Supplementary_genotype uba-1(it129) IV ; ufIs231|"Temperature-sensitive. Maintain at 15C. Phenotype dependent upon time of temperature shift: embryonic shift is Let, L3 shift is Spe, adult shift is Emb, additional defects include variations in body size, male tail defects, and paralysis. [NOTE (04/22/13): it appears this strain is carrying an unknown Him mutation.] Reference: Kulkarni M, Smith HE. PLoS Genet. 2008 Jul 18;4(7):e1000131."|"WBStrain mapped, WBPaper00060142 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00033486 Copy   


  • RRID:WB-STRAIN:WBStrain00033487

http://www.wormbase.org/db/get?name=WBStrain00033487

Source Database: WormBase (WB)
Affected Genes: WBGene00001079(dpy-20)|WBGene00002363(let-92)|WBGene00006759(unc-22)|WBGene00007732(spe-44)
Genomic Alteration: WBGene00001079(dpy-20), WBGene00002363(let-92), WBGene00006759(unc-22), WBGene00007732(spe-44)
Availability: available
Source References: EMPTY
Synonyms: spe-44(ok1400) dpy-20(e1282)/let-92(s677) unc-22(s7) IV.
Alternate IDs: WB-STRAIN:RV120, CGC_RV120
Notes: Pick wild-type to maintain.

Proper citation: RRID:WB-STRAIN:WBStrain00033487 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X