Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00027531
Source Database: WormBase (WB)
Affected Genes: WBGene00002169(isw-1)
Genomic Alteration: WBGene00002169(isw-1)
Availability: available
Source References: PMID:31397537, PMID:38190406
Synonyms: isw-1(n3294) III.
Alternate IDs: WB-STRAIN:MT15795, CGC_MT15795
Notes: Wild type vulva; semi-sterile. Suppressor of lin-53(n833) and lin-15(n767).
Proper citation: RRID:WB-STRAIN:WBStrain00027531 Copy
http://www.wormbase.org/db/get?name=WBStrain00027532
Source Database: WormBase (WB)
Affected Genes: WBGene00003334(mir-240)
Genomic Alteration: WBGene00003334(mir-240)
Availability: available
Source References: EMPTY
Synonyms: mir-240(n4541) X.
Alternate IDs: WB-STRAIN:MT15873, CGC_MT15873
Notes: Deletion breakpoints are:TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027532 Copy
http://www.wormbase.org/db/get?name=WBStrain00027557
Source Database: WormBase (WB)
Affected Genes: WBGene00003288(mir-60)
Genomic Alteration: WBGene00003288(mir-60)
Availability: available
Source References: EMPTY
Synonyms: mir-60(n4947) II.
Alternate IDs: WB-STRAIN:MT16471, CGC_MT16471
Notes: Deletion breakpoints are:GAAACTTGTTCTGATACAGTA / ATTTTCAAAGAACCATCCATG...GGGCTTATGGAATGGTAG / ATAGTTGAGACACAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GAAACTTGTTCTGATACAGTA / ATTTTCAAAGAACCATCCATG...GGGCTTATGGAATGGTAG / ATAGTTGAGACACAGAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027557 Copy
http://www.wormbase.org/db/get?name=WBStrain00027558
Source Database: WormBase (WB)
Affected Genes: WBGene00006697(uaf-1)
Genomic Alteration: WBGene00006697(uaf-1)
Availability: available
Source References: EMPTY
Synonyms: uaf-1(n4588) III.
Alternate IDs: WB-STRAIN:MT16492, CGC_MT16492
Notes: Suppressor of unc-93(e1500). Weak maternal effect sterile and dumpy. Reference: Ma L, Horvitz HR. PLoS Genet. 2009 Nov;5(11):e1000708.
Proper citation: RRID:WB-STRAIN:WBStrain00027558 Copy
http://www.wormbase.org/db/get?name=WBStrain00027579
Source Database: WormBase (WB)
Affected Genes: WBGene00012802(set-25)
Genomic Alteration: WBGene00012802(set-25)
Availability: available
Source References: PMID:33594200
Synonyms: set-25(n5021) III.
Alternate IDs: WB-STRAIN:MT17463, CGC_MT17463
Notes: Contained background Let mutation that was lost during outcrossing. Reference: Development 134(16):2991-9 (2007).|"Made_by: Erik Anderson"
Proper citation: RRID:WB-STRAIN:WBStrain00027579 Copy
http://www.wormbase.org/db/get?name=WBStrain00027516
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003036(lin-53)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003036(lin-53)
Availability: available
Source References: PMID:31397537
Synonyms: lin-53(n3368) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:MT15107, CGC_MT15107
Notes: Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3368 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.Class B SynMuv, Ste, Pvul. Reference: Harrison MM, Ceol CJ, Lu X, Horvitz HR. PNAS. 2006 Nov 7;103(45):16782-7.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027516 Copy
http://www.wormbase.org/db/get?name=WBStrain00027505
Source Database: WormBase (WB)
Affected Genes: WBGene00003306(mir-78)
Genomic Alteration: WBGene00003306(mir-78)
Availability: available
Source References: EMPTY
Synonyms: mir-78(n4637) IV.
Alternate IDs: WB-STRAIN:MT15021, CGC_MT15021
Notes: Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027505 Copy
http://www.wormbase.org/db/get?name=WBStrain00027588
Source Database: WormBase (WB)
Affected Genes: WBGene00003334(mir-240)|WBGene00045343(mir-786)
Genomic Alteration: WBGene00003334(mir-240), WBGene00045343(mir-786)
Availability: available
Source References: EMPTY
Synonyms: mir-240&mir-786(n4541) X.
Alternate IDs: WB-STRAIN:MT18043, CGC_MT18043
Notes: Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"
Proper citation: RRID:WB-STRAIN:WBStrain00027588 Copy
http://www.wormbase.org/db/get?name=WBStrain00027645
Source Database: WormBase (WB)
Affected Genes: WBGene00016935(ifta-1)
Genomic Alteration: WBGene00016935(ifta-1)
Availability: available
Source References: PMID:38302462
Synonyms: ifta-1(nx61) X.
Alternate IDs: WB-STRAIN:MX124, CGC_MX124
Notes: Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA.
Proper citation: RRID:WB-STRAIN:WBStrain00027645 Copy
http://www.wormbase.org/db/get?name=WBStrain00027647
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:31422888, PMID:33820969, PMID:34622777, PMID:38564369, PMID:38865452
Synonyms: wild
Alternate IDs: WB-STRAIN:MY1, CGC_MY1
Notes: Natural isolate; obtained in April 2002 from compost heap in Lingen, Emsland, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU1.
Proper citation: RRID:WB-STRAIN:WBStrain00027647 Copy
http://www.wormbase.org/db/get?name=WBStrain00027664
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369, PMID:38865452, PMID:39303031
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY18, CGC_MY18
Notes: Natural isolate. Obtained in October 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype EU4.
Proper citation: RRID:WB-STRAIN:WBStrain00027664 Copy
http://www.wormbase.org/db/get?name=WBStrain00027977
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369, PMID:38865452
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY795
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.|"species identified with species specific primers"
Proper citation: RRID:WB-STRAIN:WBStrain00027977 Copy
http://www.wormbase.org/db/get?name=WBStrain00028491
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369, PMID:38865452
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY2573
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.|"species identified with species specific primers"
Proper citation: RRID:WB-STRAIN:WBStrain00028491 Copy
http://www.wormbase.org/db/get?name=WBStrain00028699
Source Database: WormBase (WB)
Affected Genes: WBGene00000426(ced-12)
Genomic Alteration: WBGene00000426(ced-12)
Availability: available
Source References: PMID:33759761
Synonyms: ced-12(k149) I.
Alternate IDs: WB-STRAIN:NF87, CGC_NF87
Notes: Cell corpses persist as unengulfed, refractile dics. DTC mismigrates. Sequenced: point mutation R38>STOP, probably a null.|"WBStrain provided so WBPaper00061198 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00028699 Copy
http://www.wormbase.org/db/get?name=WBStrain00028651
Source Database: WormBase (WB)
Affected Genes: WBGene00000044(acr-5)
Genomic Alteration: WBGene00000044(acr-5)
Availability: available
Source References: PMID:38338915
Synonyms: acr-5(ok180) III.
Alternate IDs: WB-STRAIN:NC293, CGC_NC293
Notes: Made_by: Von Stetina/D Miller|"No obvious phenotype. 2 kb deletion of acr-5 produced by Moulder/Barstead at OMRF. Deletion removes all 4 transmembrane domains. This is likely a null allele. Left breakpoint sequence (includes repeated sequence): TTTTTAATTATCCGTAATTTTTTAATTATCCGTAAT. Right breakpoint sequence: AACATCTTTAATCGATTTAT."
Proper citation: RRID:WB-STRAIN:WBStrain00028651 Copy
http://www.wormbase.org/db/get?name=WBStrain00028646
Source Database: WormBase (WB)
Affected Genes: WBGene00001079(dpy-20)
Genomic Alteration: WBGene00001079(dpy-20)
Availability: available
Source References: EMPTY
Synonyms: wdIs4 II; dpy-20(e1282) IV.
Alternate IDs: WB-STRAIN:NC197, CGC_NC197
Notes: Made_by: Lickteig/Ross/Miller|"wdIs4 [unc-4::GFP + dpy-20(+)] II. Slightly Unc. GFP expression mosaic, occasional DA axon guidance defects. Embryonic expression: I5, DA, SABS; L1: AVF, VA; Late L3: VC. Early L1: GFP bright in I5, SABs, DA8/9, dim in DA1."
Proper citation: RRID:WB-STRAIN:WBStrain00028646 Copy
Source Database: Bloomington Drosophila Stock Center (BDSC)
Affected Genes: Sfmbt, UAS, v, y
Genomic Alteration: Chromosome 1, Chromosome 3
Availability: available
Alternate IDs: BDSC_28677, BDSC:28677, BL28677
Notes: Donor: Transgenic RNAi Project
Proper citation: RRID:BDSC_28677 Copy
Source Database: Bloomington Drosophila Stock Center (BDSC)
Affected Genes: sca, UAS, v, y
Genomic Alteration: Chromosome 1, Chromosome 3
Availability: available
Alternate IDs: BDSC_28675, BDSC:28675, BL28675
Notes: Donor: Transgenic RNAi Project
Proper citation: RRID:BDSC_28675 Copy
Source Database: Bloomington Drosophila Stock Center (BDSC)
Affected Genes: Ser, UAS, v, y
Genomic Alteration: Chromosome 1, Chromosome 3
Availability: available
Alternate IDs: BDSC_28713, BDSC:28713, BL28713
Notes: Donor: Transgenic RNAi Project
Proper citation: RRID:BDSC_28713 Copy
Source Database: Bloomington Drosophila Stock Center (BDSC)
Affected Genes: sna, UAS, v, y
Genomic Alteration: Chromosome 1, Chromosome 3
Availability: available
Alternate IDs: BDSC_28679, BDSC:28679, BL28679
Notes: Donor: Transgenic RNAi Project
Proper citation: RRID:BDSC_28679 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
