Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 81 showing 1601 ~ 1620 out of 40,344 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00034606

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034606

Source Database: WormBase (WB)
Affected Genes: WBGene00000383(cdc-14)
Genomic Alteration: WBGene00000383(cdc-14)
Availability: available
Source References: EMPTY
Synonyms: cdc-14(he141) II.
Alternate IDs: WB-STRAIN:SV557, CGC_SV557
Notes: Extra cell divisions within several cell lineages.|"Made_by: R.M. Saito"

Proper citation: RRID:WB-STRAIN:WBStrain00034606 Copy   


  • RRID:WB-STRAIN:WBStrain00034657

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034657

Source Database: WormBase (WB)
Affected Genes: WBGene00000438(ceh-14)
Genomic Alteration: WBGene00000438(ceh-14)
Availability: available
Source References: PMID:10774727, PMID:37587694
Synonyms: ceh-14(ch3) X.
Alternate IDs: WB-STRAIN:TB528, CGC_TB528
Notes: PHA and PHB dye-filling defect. About 50% athermotactic. ch3 deletes exon 3, causes frameshift and premature stop. [NOTE: Miyazaki, et al. (2022) report that this strain carries the fln-2(ot611) mutation in the background.]

Proper citation: RRID:WB-STRAIN:WBStrain00034657 Copy   


  • RRID:WB-STRAIN:WBStrain00034663

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034663

Source Database: WormBase (WB)
Affected Genes: WBGene00000467(cep-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000467(cep-1), WBGene00006843(unc-119)
Availability: available
Source References: PMID:31717869, PMID:38483995
Synonyms: cep-1(lg12501) I; unc-119 (ed4) III; gtIs1[CEP-1::GFP + unc-119 (+)]
Alternate IDs: WB-STRAIN:TG12, CGC_TG12
Notes: gtIs1[CEP-1::GFP + unc-119(+)]. GFP expression in germ line of adult worms (20-40 hours post L4) in the late pacytene area in the nucleus. Also expression in alae and a few nuclei in the pharynx. Compound microscope needed to see staining.|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."

Proper citation: RRID:WB-STRAIN:WBStrain00034663 Copy   


  • RRID:WB-STRAIN:WBStrain00034665

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034665

Source Database: WormBase (WB)
Affected Genes: WBGene00020142(aak-2)
Genomic Alteration: WBGene00020142(aak-2)
Availability: available
Source References: PMID:33602504, PMID:33654835, PMID:34610328, PMID:37782016
Synonyms: aak-2(ok524)
Alternate IDs: WB-STRAIN:TG38, CGC_TG38
Notes: 606bp deletion:Starts at position 3979, deletes exon 3|"Hypersensitive to oxidative stress, heat, and UV. 606 bp deletion from nucleotide 22 of Exon 3 to nucleotide 160 of Intron 3."|"Mutagen:UV/TMP"|"Supplementary_genotype aak-2(gt33)"|"WBStrain mapped, WBPaper00061072 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061110 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00034665 Copy   


  • RRID:WB-STRAIN:WBStrain00034666

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034666

Source Database: WormBase (WB)
Affected Genes: WBGene00020442(gen-1)
Genomic Alteration: WBGene00020442(gen-1)
Availability: available
Source References: EMPTY
Synonyms: gen-1(tm2940) III.
Alternate IDs: WB-STRAIN:TG1540, CGC_TG1540
Notes: Reference: Bailly AP, et al. PLoS Genet. 2010 Jul 15;6(7):e1001025. Agostinho A, et al. PLos Genetics 2013.

Proper citation: RRID:WB-STRAIN:WBStrain00034666 Copy   


  • RRID:WB-STRAIN:WBStrain00034746

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034746

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; ddIs128.
Alternate IDs: WB-STRAIN:TH214, CGC_TH214
Notes: ddIs128 [ify-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)

Proper citation: RRID:WB-STRAIN:WBStrain00034746 Copy   


  • RRID:WB-STRAIN:WBStrain00034719

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034719

Source Database: WormBase (WB)
Affected Genes: WBGene00004027(pie-1)
Genomic Alteration: WBGene00004027(pie-1)
Availability: unknown
Source References: PMID:31645459
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:TH66
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00034719 Copy   


  • RRID:WB-STRAIN:WBStrain00034771

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034771

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; ddIs159.
Alternate IDs: WB-STRAIN:TH246, CGC_TH246
Notes: ddIs159 [arx-2::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)

Proper citation: RRID:WB-STRAIN:WBStrain00034771 Copy   


  • RRID:WB-STRAIN:WBStrain00034806

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034806

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:38964319
Synonyms: unc-119(ed3) III; ddIs290.
Alternate IDs: WB-STRAIN:TH502, CGC_TH502
Notes: ddIs290 [sax-7::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)|"WBStrain provided so WBPaper00060449 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00034806 Copy   


  • RRID:WB-STRAIN:WBStrain00034892

    This resource has 10+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034892

Source Database: WormBase (WB)
Affected Genes: WBGene00000912(daf-16)|WBGene00004397(rol-6)
Genomic Alteration: WBGene00000912(daf-16), WBGene00004397(rol-6)
Availability: available
Source References: PMID:29956725, PMID:31432005, PMID:31645584, PMID:32010481, PMID:32289633, PMID:32453327, PMID:32535316, PMID:32707947, PMID:32768194, PMID:32875367, PMID:32163353, PMID:33319173, PMID:33382195, PMID:33471780, PMID:33159585, PMID:33809299, PMID:33883621, PMID:33956916, PMID:34449775, PMID:34505574, PMID:33851304, PMID:34544019, PMID:34607947, PMID:34634043, PMID:34648748, PMID:36626986, PMID:36794357, PMID:37118502, PMID:37122724, PMID:37440595, PMID:37454110, PMID:37500972, PMID:37639584, PMID:37704756, PMID:37726773, PMID:37422249, PMID:37910615, PMID:38378098, PMID:38532074, PMID:38632209, PMID:38746662, PMID:38754743, PMID:39273603, PMID:39731224, PMID:39708289
Synonyms: zIs356 [daf-16p::daf-16a/b::GFP+rol-6(su1006)]
Alternate IDs: WB-STRAIN:TJ356, CGC_TJ356
Notes: Alt genotype from publication : [daf-16p::daf-16a/b::GFP + rol-6(su1006)]|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain."|"Mutagen:Gamma rays"|"Reference WBPaper00054805 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00057259 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058750 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00059256 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype (zIs356[daf-16p::daf-16a/b::GFP + rol-6(su1006)])"|"Supplementary_genotype (zIs356[daf-16p::daf-16a/b::GFP + rol-6])"|"Supplementary_genotype daf-16p::daf-16a/b::GFP zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]"|"Supplementary_genotype zIs356 V [daf-16p::daf-16::gfp + rol-6(su1006)]"|"Supplementary_genotype zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]"|"Supplementary_genotype [daf-16p::daf-16a/b::GFP + rol-6(su1006) II.]"|"WBStrain mapped, WBPaper00059685 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060064 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060204 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060824 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060896 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061006 added based on AFP_Strain data."|"WBStrain provided so WBPaper00049531 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00059548 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00059721 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00059884 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00059960 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060133 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060134 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060223 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060410 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060420 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060449 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060456 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060484 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060486 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060487 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060495 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060545 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060602 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060669 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060692 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060708 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060742 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060778 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060797 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060809 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060840 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060850 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060924 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060976 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061045 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061102 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061130 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061159 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061236 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061243 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061245 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061297 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061313 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061319 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061385 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061396 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061436 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061452 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061495 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061547 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061583 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061584 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061624 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061641 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061646 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061671 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061698 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061738 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061748 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061750 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061786 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061791 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061836 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061837 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061852 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061869 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061870 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061871 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061890 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061895 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061902 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061904 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061915 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061925 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061938 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061998 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062031 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062037 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062064 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062068 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062084 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062091 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062110 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062125 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062141 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062146 paper added based on AFP_Strain data."|"zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson. Correspondence: [email protected]. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects."|"zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson?. ?Correspondence: [email protected]. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145."

Proper citation: RRID:WB-STRAIN:WBStrain00034892 Copy   


  • RRID:WB-STRAIN:WBStrain00034895

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034895

Source Database: WormBase (WB)
Affected Genes: WBGene00002016(hsp-16.2)
Genomic Alteration: WBGene00002016(hsp-16.2)
Availability: available
Source References: PMID:29956725, PMID:31432005, PMID:31510078, PMID:31331055, PMID:32535316, PMID:32707947, PMID:33006972, PMID:33183600, PMID:33809299, PMID:34196492, PMID:34407398, PMID:35045336, PMID:37416472, PMID:37254351, PMID:37443152, PMID:38852157, PMID:39273603
Synonyms: gpIs1.
Alternate IDs: WB-STRAIN:TJ375, CGC_TJ375
Notes: gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Insertion not mapped.|"Made_by: Henderson and Link"|"Mutagen:Gamma Rays"|"Reference WBPaper00054805 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00057259 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058621 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058626 added based on published strain data identified by Textpresso literature search."|"WBStrain provided so WBPaper00060410 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061585 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061805 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00034895 Copy   


  • RRID:WB-STRAIN:WBStrain00034928

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034928

Source Database: WormBase (WB)
Affected Genes: WBGene00000608(col-19)
Genomic Alteration: WBGene00000608(col-19)
Availability: available
Source References: PMID:33289480, PMID:33789349, PMID:38177158, PMID:38378098
Synonyms: kaIs12[col-19::GFP]
Alternate IDs: WB-STRAIN:TP12, CGC_TP12
Notes: kaIs12 [col-19::GFP]. Collagen COL-19 with GFP fused to C-terminus localized in the cuticle.|"Made_by: M. Thein"|"Mutagen:Gamma rays"|"WBStrain mapped, WBPaper00060738 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061220 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00034928 Copy   


  • RRID:WB-STRAIN:WBStrain00034903

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034903

Source Database: WormBase (WB)
Affected Genes: WBGene00004510(rrf-3)|WBGene00004963(spe-9)
Genomic Alteration: WBGene00004510(rrf-3), WBGene00004963(spe-9)
Availability: available
Source References: PMID:8303273, PMID:7973641, PMID:8583834, PMID:11708615, PMID:37175557, PMID:37644339, PMID:37884488, PMID:38177158
Synonyms: spe-9(hc88) I; rrf-3(b26) II.
Alternate IDs: WB-STRAIN:TJ1060, CGC_TJ1060
Notes: Made_by: T. Fabian|"Supplementary_genotype spe-9(hc88) I; rrf-3(b26) II"|"Supplementary_genotype [spe-9(hc88)]"|"Temperature sensitive. Maintain at 15C. See also WBPaper00002184."

Proper citation: RRID:WB-STRAIN:WBStrain00034903 Copy   


  • RRID:WB-STRAIN:WBStrain00034909

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034909

Source Database: WormBase (WB)
Affected Genes: WBGene00003225(mev-1)
Genomic Alteration: WBGene00003225(mev-1)
Availability: available
Source References: PMID:31717869, PMID:32009302, PMID:33542359, PMID:33883621, PMID:36774344, PMID:37427543, PMID:37957360, PMID:38790689
Synonyms: mev-1(kn1) III.
Alternate IDs: WB-STRAIN:TK22, CGC_TK22
Notes: Methylviologen (paraquat) sensitive. Oxygen sensitive. Short life span.|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype mev-1(kn1) III"

Proper citation: RRID:WB-STRAIN:WBStrain00034909 Copy   


  • RRID:WB-STRAIN:WBStrain00034950

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034950

Source Database: WormBase (WB)
Affected Genes: WBGene00006801(unc-68)
Genomic Alteration: WBGene00006801(unc-68)
Availability: available
Source References: PMID:31162948, PMID:33820857
Synonyms: unc-68(r1162) V.
Alternate IDs: WB-STRAIN:TR2171, CGC_TR2171
Notes: Homozygous viable Unc. Males do not mate.|"Reference WBPaper00056839 added based on published strain data identified by Textpresso literature search."|"WBStrain provided so WBPaper00061245 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00034950 Copy   


  • RRID:WB-STRAIN:WBStrain00034931

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034931

Source Database: WormBase (WB)
Affected Genes: WBGene00006615(trp-2)
Genomic Alteration: WBGene00006615(trp-2)
Availability: available
Source References: PMID:37155851
Synonyms: trp-2(sy691) III.
Alternate IDs: WB-STRAIN:TQ194, CGC_TQ194
Notes: Mutagen:UV/TMP

Proper citation: RRID:WB-STRAIN:WBStrain00034931 Copy   


  • RRID:WB-STRAIN:WBStrain00034936

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034936

Source Database: WormBase (WB)
Affected Genes: WBGene00008443(pde-3)|WBGene00011146(pde-2)|WBGene00011433(pde-1)|WBGene00016328(pde-5)
Genomic Alteration: WBGene00008443(pde-3), WBGene00011146(pde-2), WBGene00011433(pde-1), WBGene00016328(pde-5)
Availability: available
Source References: EMPTY
Synonyms: pde-1(nj57) pde-5(nj49) I; pde-3(nj59) II; pde-2(tm3098) III.
Alternate IDs: WB-STRAIN:TQ1828, CGC_TQ1828
Notes: Maintain under normal conditions. Reference: Liu J, et al (2010) Nature Neurosci 13:715-22.|"Mutagen:TMP+UV"|"Mutagen:TMP/UV"

Proper citation: RRID:WB-STRAIN:WBStrain00034936 Copy   


  • RRID:WB-STRAIN:WBStrain00035044

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035044

Source Database: WormBase (WB)
Affected Genes: WBGene00000950(deg-1)
Genomic Alteration: WBGene00000950(deg-1)
Availability: available
Source References: PMID:7627559
Synonyms: deg-1(u506) X.
Alternate IDs: WB-STRAIN:TU1366, CGC_TU1366
Notes: Recessive gain-of-function. Codon 393 changed from alanine (GCT) to threonine (ACT). Deg and Tab at all temperatures. Lethal at 15C (embryos arrest at the two-fold stage, larvae survive).

Proper citation: RRID:WB-STRAIN:WBStrain00035044 Copy   


  • RRID:WB-STRAIN:WBStrain00035055

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035055

Source Database: WormBase (WB)
Availability: available
Source References: PMID:33319173, PMID:38378098
Synonyms: uls60 [unc-119p::YFP+unc-119p::sid-1]
Alternate IDs: WB-STRAIN:TU3311, CGC_TU3311
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"Made_by: Calixto & Topalidou"|"uIs60 [unc-119p::YFP + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. YFP detectable in neurons. Maintain 15-20 degrees. Reference: Calixto et al. (2010) Nature Methods 7:554-9."|"WBStrain provided so WBPaper00060459 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060797 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00035055 Copy   


  • RRID:WB-STRAIN:WBStrain00035058

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035058

Source Database: WormBase (WB)
Affected Genes: WBGene00004795(sid-1)
Genomic Alteration: WBGene00004795(sid-1)
Availability: available
Source References: PMID:37857834
Synonyms: ccIs4251 I; sid-1(qt2) V; uIs71.
Alternate IDs: WB-STRAIN:TU3403, CGC_TU3403
Notes: ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. uIs71 [(pCFJ90) myo-2p::mCherry + mec-18p::sid-1]. TRN-specific feeding RNAi. Reference: Calixto et al. (2010) Nature Methods 7:554-9.|"Supplementary_genotype ccIs4251 ((pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)) Isid-1 (qt2) V uIs71 ((pCFJ90) myo-2p::mCherry + mec-18p::sid-1)"

Proper citation: RRID:WB-STRAIN:WBStrain00035058 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X