Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00042063
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:28903981
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:RS2956
Notes: Non-elegans Strain
Proper citation: RRID:WB-STRAIN:WBStrain00042063 Copy
http://www.wormbase.org/db/get?name=WBStrain00047686
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021868(atln-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021868(atln-1)
Availability: unknown
Synonyms: atln-1(gk5537[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV.
Notes: Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4161 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATTCTCCATTATCCGGATTCTCGTGGCGT; Right flanking sequence: TGGAACGGTTGGAATCTGATTTGCAGGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00047686 Copy
http://www.wormbase.org/db/get?name=WBStrain00047778
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32209461
Synonyms: metr-1(ok521) II Pf53f4.13::GFP Posm-10::mCherry (yadIs48) II
Notes: Imported from supporting material
Proper citation: RRID:WB-STRAIN:WBStrain00047778 Copy
http://www.wormbase.org/db/get?name=WBStrain00047846
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32666045
Synonyms: let-23(sa62)gf inIs179[ida-1p::gfp] II; sbp-1(ep79) III; pnc-1(pk9605) IV
Notes: [2020-07-28T18:21:36.919Z WBPerson2987] New Strain: WBPaper00059770, genotype: let-23(sa62)gf inIs179[ida-1p::gfp] II; sbp-1(ep79) III; pnc-1(pk9605) IV
Proper citation: RRID:WB-STRAIN:WBStrain00047846 Copy
http://www.wormbase.org/db/get?name=WBStrain00047966
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33005883
Synonyms: gld-2(q497) gld-1(q485)/hT2::gfp [bli-4(e937) let-?(q782) qIs48] (I); ieSi64 [gld-1p::TIR1::mRuby::gld-1 3 Prime UTR + Cbr-unc-119(+)] (II); glp-1(ar202)/hT2::gfp [bli-4(e937) let-?(q782) qIs48] (III); lag-1(oz536oz537[lag-1::degron::3xHA]) (IV)
Notes: [2020-09-17T03:28:57.633Z WBPerson712] New Strain: DOI10.17912/micropub.biology.000310 WBPaper00060255 BS5629: gld-2(q497) gld-1(q485)/hT2::gfp [bli-4(e937) let-?(q782) qIs48] (I); ieSi64 [gld-1p::TIR1::mRuby::gld-1 3 Prime UTR + Cbr-unc-119(+)] (II); glp-1(ar202)/hT2::gfp [bli-4(e937) let-?(q782) qIs48] (III); lag-1(oz536oz537[lag-1::degron::3xHA]) (IV)
Proper citation: RRID:WB-STRAIN:WBStrain00047966 Copy
http://www.wormbase.org/db/get?name=WBStrain00048554
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32149606, PMID:38450962
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"WBStrain provided so WBPaper00061495 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00048554 Copy
http://www.wormbase.org/db/get?name=WBStrain00048736
Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Notes: Modern strain accessioned as a batch with get_NS_ids.pl
Proper citation: RRID:WB-STRAIN:WBStrain00048736 Copy
http://www.wormbase.org/db/get?name=WBStrain00048652
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33659873, PMID:37488107, PMID:38177330, PMID:39255003
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048652 Copy
http://www.wormbase.org/db/get?name=WBStrain00048812
Source Database: WormBase (WB)
Availability: unknown
Synonyms: EMPTY
Notes: Modern strain accessioned as a batch with get_NS_ids.pl
Proper citation: RRID:WB-STRAIN:WBStrain00048812 Copy
http://www.wormbase.org/db/get?name=WBStrain00048922
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34549171
Synonyms: pup-1/-2(om129)/qC1gfp;him-8(e1489) LGIII;IV.
Notes: [2021-09-04T05:55:42.765Z WBPerson712] New Strain: WBPaper00061881 10.17912/micropub.biology.000455 EL624 pup-1/-2(om129)/qC1gfp;him-8(e1489) LGIII;IV
Proper citation: RRID:WB-STRAIN:WBStrain00048922 Copy
http://www.wormbase.org/db/get?name=WBStrain00048852
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34172445
Synonyms: hpIs228[rgef-1p::FUS(R522G)::GFP]
Notes: [2021-08-10T00:12:50.289Z WBPerson324] New Strain: WBPaper00061562 Genotype: hpIs228[rgef-1p::FUS(R522G)::GFP]
Proper citation: RRID:WB-STRAIN:WBStrain00048852 Copy
http://www.wormbase.org/db/get?name=WBStrain00049062
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33974063
Synonyms: EMPTY
Notes: Generated from afp_otherstrain Paper data WBPaper000613991.
Proper citation: RRID:WB-STRAIN:WBStrain00049062 Copy
http://www.wormbase.org/db/get?name=WBStrain00047070
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:24613396
Synonyms: blmp-1(tm548) I.
Notes: Batch Strain object requested via get_NS_ids.pl
Proper citation: RRID:WB-STRAIN:WBStrain00047070 Copy
http://www.wormbase.org/db/get?name=WBStrain00047111
Source Database: WormBase (WB)
Affected Genes: WBGene00000912(daf-16)
Genomic Alteration: WBGene00000912(daf-16)
Availability: unknown
Source References: PMID:34505574
Synonyms: daf-16(ot853[daf-16::linker::mNG::3xFlag::AID]) I.
Notes: Batch Strain object. This strain is detailed in micropub-biology-000210|"mNeonGreen tag inserted into endogenous daf-16 locus; AID at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580"
Proper citation: RRID:WB-STRAIN:WBStrain00047111 Copy
http://www.wormbase.org/db/get?name=WBStrain00047307
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32550518, PMID:34585102
Synonyms: EMPTY
Notes: Non-elegans Strain|"[2020-05-21T23:48:12.911Z WBPerson712] New Strain: C. tropicalis WBPaper00059661"
Proper citation: RRID:WB-STRAIN:WBStrain00047307 Copy
http://www.wormbase.org/db/get?name=WBStrain00047257
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33677541, PMID:37651423, PMID:37773960, PMID:38483995
Synonyms: reSi1[col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] I:-5.32
Notes: Made_by: Tam Duong|"reSi1 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei."|"Supplementary_genotype reSi1 [col-10p::TIR1::F2A::mTagBFP2:: AID*::NLS::tbb-2 3'UTR] I"|"Supplementary_genotype reSi1[Pcol-10::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR]"|"WBStrain mapped, WBPaper00061130 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00047257 Copy
http://www.wormbase.org/db/get?name=WBStrain00047291
Source Database: WormBase (WB)
Availability: unknown
Synonyms: goeEx737.
Notes: goeEx737 [flp-24p::SL1::GCaMP3.35-SL2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. ALA-specific expression of GCaMP with an additional mKate marker for expression reference. Pick mKate+ to maintain. High transmission rate (>99%). Reference: Konietzka et al. 2019. Current Biology (accepted).|"Made_by: Dr. Jan Konietzka"
Proper citation: RRID:WB-STRAIN:WBStrain00047291 Copy
http://www.wormbase.org/db/get?name=WBStrain00047527
Source Database: WormBase (WB)
Affected Genes: WBGene00002276(lem-3)
Genomic Alteration: WBGene00002276(lem-3)
Availability: unknown
Synonyms: lem-3(tm3468) I.
Notes: Homozygous viable. Increased embryonic lethality after irradiation.|"Made_by: S. Mitani/NBRP"
Proper citation: RRID:WB-STRAIN:WBStrain00047527 Copy
http://www.wormbase.org/db/get?name=WBStrain00044016
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33673074, PMID:37906605
Synonyms: EMPTY
Notes: Generated based on CalTech XREF data|"Supplementary_genotype sid-1(qt9)"|"WBStrain mapped, WBPaper00061131 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00044016 Copy
http://www.wormbase.org/db/get?name=WBStrain00044717
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32010883
Synonyms: EMPTY
Notes: Generated based on CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00044717 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
