Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00063349
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: wbmIs79 *wbmIs67 V.
Notes: wbmIs79 [eft-3p::3XFLAG::raga-1::SL2::wrmScarlet::unc-54 3'UTR] *wbmIs67. Somatic-specific RAGA-1 and wrmScarlet expression driven by the eft-3p promoter. Derived by CRISPR-mediated insertion of raga-1 downstream of tissue-specific eft-3 promoter of wbmIs67 insertion in parental strain WBM1143. wbmIs67 [eft-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs65] (V:8645000). Reference: Zhang Y, et al. Elife. 2019 Aug 14;8:e49158. doi: 10.7554/eLife.49158. PMID: 31411562.
Proper citation: RRID:WB-STRAIN:WBStrain00063349 Copy
http://www.wormbase.org/db/get?name=WBStrain00046349
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00046349 Copy
http://www.wormbase.org/db/get?name=WBStrain00044818
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00044818 Copy
http://www.wormbase.org/db/get?name=WBStrain00046681
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00046681 Copy
http://www.wormbase.org/db/get?name=WBStrain00045074
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00045074 Copy
http://www.wormbase.org/db/get?name=WBStrain00045065
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00045065 Copy
http://www.wormbase.org/db/get?name=WBStrain00063339
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C09B9.85(hd7184[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 3777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCTGTGCAGATCCAACTAGGGCGTCTCCA; Right flanking sequence: AGGAAATTTTTGTCGAAAATTCTGAAAAAT. sgRNA #1: CATGGTATGGATGGAAGCAT; sgRNA #2: CAAAGTTAGCAATTTTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00063339 Copy
http://www.wormbase.org/db/get?name=WBStrain00045114
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00045114 Copy
http://www.wormbase.org/db/get?name=WBStrain00063391
Source Database: WormBase (WB)
Affected Genes: WBGene00018854(nlf-1)
Genomic Alteration: WBGene00018854(nlf-1)
Availability: unknown
Source References: EMPTY
Synonyms: nlf-1(hp428) X.
Notes: Fainter. hp428 is a G to A substitution that alters the 3 splice junction of the first intron resulting in a single base pair deletion in the hp428 cDNA causing a frame-shift and premature stop. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. doi: 10.1016/j.neuron.2013.01.018. PMID: 23522043.
Proper citation: RRID:WB-STRAIN:WBStrain00063391 Copy
http://www.wormbase.org/db/get?name=WBStrain00046652
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00046652 Copy
http://www.wormbase.org/db/get?name=WBStrain00063397
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:40321834
Synonyms: W01A8.6(oxTi1128[mex-5p::Cas9(+smu-2 introns), hsp-16.41::Cre, myo-2p::2XNLS-CyOFP + lox2272])
Notes: Strain : ACR174 Reference : WBPaper00068012 Genotype : W01A8.6(oxTi1128[mex-5p::Cas9(+smu-2 introns), hsp-16.41::Cre, myo-2p::2XNLS-CyOFP + lox2272]) Remark : DOI 10.17912/micropub.biology.001542 Remark : obtained after removing unc-119(ed3) from the background of EG9887 Species: Caenorhabditis elegans
Proper citation: RRID:WB-STRAIN:WBStrain00063397 Copy
http://www.wormbase.org/db/get?name=WBStrain00063398
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:40321834
Synonyms: reySi01[mex-5p::NbALFA::mKate2_ nmy-2 3'UTR] II
Notes: Strain : ACR194 Reference : WBPaper00068012 Genotype : reySi01[mex-5p::NbALFA::mKate2_ nmy-2 3'UTR] II Remark : DOI 10.17912/micropub.biology.001542 Species: Caenorhabditis elegans
Proper citation: RRID:WB-STRAIN:WBStrain00063398 Copy
http://www.wormbase.org/db/get?name=WBStrain00063395
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: zzyIs139 II; zuIs178; stIs10024.
Notes: zzyIs139 [his-72p::PH(PLC1delta1)::mCherry::pie-1 3' UTR + unc-119(+)] II. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. The membrane-specific PH(PLC1delta1) domain, labeled with mCherry, is expressed in all cell membranes. Derived by crossing parental strains carrying unc-119(ed3) and unc-119(tm4063). Unknown if either unc-119 mutation is still present in background. Reference: Cao J, et al. Nat Commun. 2020 Dec 7;11(1):6254. doi: 10.1038/s41467-020-19863-x. PMID: 33288755.
Proper citation: RRID:WB-STRAIN:WBStrain00063395 Copy
http://www.wormbase.org/db/get?name=WBStrain00063396
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(tm4063) III; ltIs44 V; stIs10024; zuIs178; zzyIs139.
Notes: ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] V. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. zzyIs139 [his-72p::PH(PLC1delta1)::mCherry::pie-1 3' UTR + unc-119(+)]. Reference: Zhao Z, et al. https:
Proper citation: RRID:WB-STRAIN:WBStrain00063396 Copy
http://www.wormbase.org/db/get?name=WBStrain00044915
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00044915 Copy
http://www.wormbase.org/db/get?name=WBStrain00044879
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00044879 Copy
http://www.wormbase.org/db/get?name=WBStrain00063399
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:40321834
Synonyms: reySi01[mex-5p::NbALFA::mKate2] II; dlg-1(tu1782[dlg-1::2XALFA]) X
Notes: Strain : ACR206 Reference : WBPaper00068012 Genotype : reySi01[mex-5p::NbALFA::mKate2] II; dlg-1(tu1782[dlg-1::2XALFA]) X Remark : DOI 10.17912/micropub.biology.001542 Remark : obtained after mating ACR194 with RS4103 Species: Caenorhabditis elegans
Proper citation: RRID:WB-STRAIN:WBStrain00063399 Copy
http://www.wormbase.org/db/get?name=WBStrain00046659
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00046659 Copy
http://www.wormbase.org/db/get?name=WBStrain00063390
Source Database: WormBase (WB)
Affected Genes: WBGene00006809(unc-77)|WBGene00006812(unc-80)
Genomic Alteration: WBGene00006809(unc-77), WBGene00006812(unc-80)
Availability: unknown
Source References: EMPTY
Synonyms: unc-77(hp102) IV; unc-80(hp369) V.
Notes: Fainter. hp369 is an early nonsense mutation in unc-80 and was isolated as a suppressor of unc-77(hp102). Reference: Yeh E, et al. PLoS Biol. 2008 Mar 11;6(3):e55. doi: 10.1371/journal.pbio.0060055. PMID: 18336069.
Proper citation: RRID:WB-STRAIN:WBStrain00063390 Copy
http://www.wormbase.org/db/get?name=WBStrain00063382
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Y53G8AR.9(thu33[Y53G8AR.9::mCherry]) III.
Notes: Made_by: Xiao Liu Lab|"mCherry was inserted at the 3' end of the endogenous Y53G8AR.9 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740."
Proper citation: RRID:WB-STRAIN:WBStrain00063382 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
