Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00063240
Source Database: WormBase (WB)
Affected Genes: WBGene00011014(hpo-30)
Genomic Alteration: WBGene00011014(hpo-30)
Availability: unknown
Source References: EMPTY
Synonyms: wyIs738 I; wyIs592 III; hpo-30(wy1220) V.
Notes: Made_by: Rebecca Shi|"wyIs738 [ser-2(prom3)::dma-1:GFP + odr-1p::GFP] I. wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. wy1220 is a CRISPR/Cas9-engineered hpo-30(R186A) substitution mutation in the furin cleavage site. Reference: Shi R, et al. 2024 bioRxiv doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00063240 Copy
http://www.wormbase.org/db/get?name=WBStrain00063244
Source Database: WormBase (WB)
Affected Genes: WBGene00006364(syd-2)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00006364(syd-2), WBGene00006752(unc-13)
Availability: unknown
Source References: EMPTY
Synonyms: unc-13(wy1322[unc-13::FLP::mScarlet-I]) I; wyIs891 III; syd-2(wy5) X.
Notes: Made_by: Nathan McDonald|"wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLP::mScarlet-I tag inserted into endogenous unc-13 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945."
Proper citation: RRID:WB-STRAIN:WBStrain00063244 Copy
http://www.wormbase.org/db/get?name=WBStrain00063242
Source Database: WormBase (WB)
Affected Genes: WBGene00018330(elks-1)
Genomic Alteration: WBGene00018330(elks-1)
Availability: unknown
Source References: EMPTY
Synonyms: elks-1(wy1397) IV.
Notes: elks-1(wy1397) is a CRISPR-engineered deletion of ELKS-1(301-3350), ELKS-1(716-775), and ELKS-1(807-836). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.|"Made_by: Nathan McDonald"
Proper citation: RRID:WB-STRAIN:WBStrain00063242 Copy
http://www.wormbase.org/db/get?name=WBStrain00063245
Source Database: WormBase (WB)
Affected Genes: WBGene00006364(syd-2)|WBGene00006750(unc-10)
Genomic Alteration: WBGene00006364(syd-2), WBGene00006750(unc-10)
Availability: unknown
Source References: EMPTY
Synonyms: wyIs891 III; unc-10(wy1235[unc-10::FLPon::mScarlet-I]) syd-2(wy1398) X.
Notes: Made_by: Nathan McDonald|"wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. syd-2(wy1398) is a GFP tag inserted into endogenous syd-2 locus with SYD-2(517-539), SYD-2(617-655), and SYD-2(731-801) regions deleted. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945."
Proper citation: RRID:WB-STRAIN:WBStrain00063245 Copy
http://www.wormbase.org/db/get?name=WBStrain00063246
Source Database: WormBase (WB)
Affected Genes: WBGene00006364(syd-2)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00006364(syd-2), WBGene00006752(unc-13)
Availability: unknown
Source References: EMPTY
Synonyms: unc-13(wy1322) I; wyIs891 III; syd-2(wy1292) X.
Notes: Made_by: Nathan McDonald|"wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. syd-2(wy1292) is a CRISPR-engineered deletion of SYD-2(517-836). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945."
Proper citation: RRID:WB-STRAIN:WBStrain00063246 Copy
http://www.wormbase.org/db/get?name=WBStrain00043981
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34090505, PMID:38692279
Synonyms: EMPTY
Notes: Generated based on CalTech XREF data|"WBStrain mapped, WBPaper00061616 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00043981 Copy
http://www.wormbase.org/db/get?name=WBStrain00063353
Source Database: WormBase (WB)
Affected Genes: WBGene00006414(raga-1)
Genomic Alteration: WBGene00006414(raga-1)
Availability: unknown
Source References: EMPTY
Synonyms: ieSi57 raga-1(wbm40[raga-1::AID::EmGFP]) II.
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Auxin-inducible degron (AID) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Somatic expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the soma. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https:|"Made_by: Hannah J Smith"
Proper citation: RRID:WB-STRAIN:WBStrain00063353 Copy
http://www.wormbase.org/db/get?name=WBStrain00063357
Source Database: WormBase (WB)
Affected Genes: WBGene00019322(ahcy-1)
Genomic Alteration: WBGene00019322(ahcy-1)
Availability: unknown
Source References: EMPTY
Synonyms: ahcy-1(syb646[ahcy-1::GFP]) I.
Notes: GFP tag inserted at C-terminus of endogenous ahcy-1 locus. Derived by out-crossing parental strain PHX646 two times to N2. Reference: Thapa P, et al. NPJ Aging. 2023 Dec 5;9(1):27. doi: 10.1038/s41514-023-00125-1. PMID: 38052822.|"Made_by: SunyBiotech"
Proper citation: RRID:WB-STRAIN:WBStrain00063357 Copy
http://www.wormbase.org/db/get?name=WBStrain00063358
Source Database: WormBase (WB)
Affected Genes: WBGene00019322(ahcy-1)
Genomic Alteration: WBGene00019322(ahcy-1)
Availability: unknown
Source References: EMPTY
Synonyms: ahcy-1(syb784 *syb646[ahcy-1(Y145C)::GFP]) I.
Notes: Engineered Y145C substitution mutation in endogenously GFP-tagged ahcy-1 locus. ahcy-1(Y145C) mutation mimics the pathogenic human mutation AHCY Y143C. ahcy-1(Y145C) mutants have a prolonged lifespan and are larger than control animals. ahcy-1(Y145C) mutants are fertile and produce a brood of laid and hatched eggs similar to control animals. ahcy-1(Y145C) mutants show a slight increase in SAH and a decrease in SAM levels, leading to an increased SAH to SAM ratio. See WOP122 for control strain. Derived by out-crossing parental strain PHX784 two times to N2. Reference: Thapa P, et al. NPJ Aging. 2023 Dec 5;9(1):27. doi: 10.1038/s41514-023-00125-1. PMID: 38052822.|"Made_by: SunyBiotech"
Proper citation: RRID:WB-STRAIN:WBStrain00063358 Copy
http://www.wormbase.org/db/get?name=WBStrain00063355
Source Database: WormBase (WB)
Affected Genes: WBGene00012474(attf-6)
Genomic Alteration: WBGene00012474(attf-6)
Availability: unknown
Source References: EMPTY
Synonyms: attf-6(how51[GFP::TEV::AID::attf-6]) I; wrdSi51 II.
Notes: Made_by: Yi-hui Wang|"wrdSi51 [mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). GFP::TEV::AID tag inserted at the N-terminus of the endogenous attf-6 locus facilitates auxin-inducible degradation of GFP::TEV::AID::ATTF-6. Reference: Wang Y, et al. Nucleic Acids Research. 2025 Feb 28; 53(4): gkaf079. doi: 10.1093/nar/gkaf079 PMID: 39945323."
Proper citation: RRID:WB-STRAIN:WBStrain00063355 Copy
http://www.wormbase.org/db/get?name=WBStrain00063356
Source Database: WormBase (WB)
Affected Genes: WBGene00012474(attf-6)
Genomic Alteration: WBGene00012474(attf-6)
Availability: unknown
Source References: EMPTY
Synonyms: WHY546 attf-6(how52[attf-6::3xflag]) I.
Notes: 3xFlag tag inserted at the C-terminus of the endogenous attf-6 locus. Reference: Wang Y, et al. Nucleic Acids Research. 2025 Feb 28; 53(4): gkaf079. doi: 10.1093/nar/gkaf079 PMID: 39945323.|"Made_by: Yi-Hui Wang"
Proper citation: RRID:WB-STRAIN:WBStrain00063356 Copy
http://www.wormbase.org/db/get?name=WBStrain00043989
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38719808, PMID:38878153
Synonyms: EMPTY
Notes: Generated based on CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00043989 Copy
http://www.wormbase.org/db/get?name=WBStrain00043477
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00043477 Copy
http://www.wormbase.org/db/get?name=WBStrain00046622
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00046622 Copy
http://www.wormbase.org/db/get?name=WBStrain00063342
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019877(lmbr-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019877(lmbr-1)
Availability: unknown
Source References: EMPTY
Synonyms: +/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ lmbr-1(hd7180 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III.
Notes: Made_by: VH KO group|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7180 and CGC66. hd7180 is a 1876 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCTTTTTACAGATTTAATAACACCAAAT; Right flanking sequence: TGGCTACAAATACCTTGAAATTGTTATTCG. sgRNA #1: GGCCCAATACGCCCTGGAGG; sgRNA #2: GACATGCTCTCTAATCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00063342 Copy
http://www.wormbase.org/db/get?name=WBStrain00063340
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019276(algn-5)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019276(algn-5)
Availability: unknown
Source References: EMPTY
Synonyms: +/nT1 [umnls49] IV; algn-5 (hd7175[loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/nT1 V.
Notes: Made_by: VH KO group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7175 and CGC63. hd7175 is a 1325 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCCAAAAAATCAATATCTTCACCATTTTCA; Right flanking sequence: TGGAGCTACAAAATTCGCCGATTTTGAAAA. sgRNA #1: GACTTTCCTACGCAACACCA; sgRNA #2: ATTCTCTTCGCAGATGCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00063340 Copy
http://www.wormbase.org/db/get?name=WBStrain00063341
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010427(hpo-11)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010427(hpo-11)
Availability: unknown
Source References: EMPTY
Synonyms: hpo-11 (hd7177 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) /hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III.
Notes: Made_by: VH KO group|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7177 and CGC92. hd7177 is a 7087 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GATGGTCCATTTGTATTAGTTGTTGTACCA; Right flanking sequence: TTTTAGTTGGAACGGCTCGCGCCCAAGCAG. sgRNA #1: CTTGGCTGTGATGATTGACC; sgRNA #2: AAACGGAACAAGGACACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00063341 Copy
http://www.wormbase.org/db/get?name=WBStrain00063347
Source Database: WormBase (WB)
Affected Genes: WBGene00016968(epg-5)
Genomic Alteration: WBGene00016968(epg-5)
Availability: unknown
Source References: EMPTY
Synonyms: epg-5(tm3425) II; vkIs3785 X.
Notes: Made_by: Zachary D. Dawson|"vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. GFP aggregation in intestine. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663."
Proper citation: RRID:WB-STRAIN:WBStrain00063347 Copy
http://www.wormbase.org/db/get?name=WBStrain00063348
Source Database: WormBase (WB)
Affected Genes: WBGene00021922(atg-3)
Genomic Alteration: WBGene00021922(atg-3)
Availability: unknown
Source References: EMPTY
Synonyms: atg-3(bp412) IV; vkIs3785 X.
Notes: Made_by: Zachary D. Dawson|"vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. Stronger GFP expression in intestine than in wild-type background. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663."
Proper citation: RRID:WB-STRAIN:WBStrain00063348 Copy
http://www.wormbase.org/db/get?name=WBStrain00045019
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data
Proper citation: RRID:WB-STRAIN:WBStrain00045019 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
