Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00031070
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00086546(inpp-5K)
Genomic Alteration: WBGene00001864(him-5), WBGene00086546(inpp-5K)
Availability: available
Source References: EMPTY
Synonyms: inpp-5K(my15) III; him-5(e1490) V.
Alternate IDs: WB-STRAIN:PT1443, CGC_PT1443
Notes: Spermatogenesis abnormal with small brood size. PKD-2::GFP ciliary localization defective. Maintain at 20 C. inpp-5K formerly known as cil-1. Reference: Bae Y, et al. 2009 Curr Bio 19(19):1599-607.
Proper citation: RRID:WB-STRAIN:WBStrain00031070 Copy
http://www.wormbase.org/db/get?name=WBStrain00031058
Source Database: WormBase (WB)
Affected Genes: WBGene00011227(nlp-67)
Genomic Alteration: WBGene00011227(nlp-67)
Availability: available
Source References: PMID:30224336
Synonyms: nlp-67(sy1176) X.
Alternate IDs: WB-STRAIN:PS8027, CGC_PS8027
Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-67; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CTCACTTTCTTGCTCGTCACTCTTTTTGCCCTCGCRight flanking sequence: CAATGTCATGCAAGCACAGCGTTACGATCGAGCCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTGCTTGCATGACATTGGCGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00031058 Copy
http://www.wormbase.org/db/get?name=WBStrain00031127
Source Database: WormBase (WB)
Affected Genes: WBGene00001535(gcy-8)
Genomic Alteration: WBGene00001535(gcy-8)
Availability: available
Source References: PMID:38530893
Synonyms: oyIs18 [gcy-8p::gfp]
Alternate IDs: WB-STRAIN:PY1322, CGC_PY1322
Notes: oyIs18 [gcy-8::GFP]. GFP in AFD.
Proper citation: RRID:WB-STRAIN:WBStrain00031127 Copy
http://www.wormbase.org/db/get?name=WBStrain00031132
Source Database: WormBase (WB)
Affected Genes: WBGene00000553(cmk-1)
Genomic Alteration: WBGene00000553(cmk-1)
Availability: available
Source References: EMPTY
Synonyms: cmk-1(oy21) IV.
Alternate IDs: WB-STRAIN:PY1589, CGC_PY1589
Notes: Thermotaxis defective.
Proper citation: RRID:WB-STRAIN:WBStrain00031132 Copy
http://www.wormbase.org/db/get?name=WBStrain00031188
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: qgIR1 (X, CB4856>N2) X.
Alternate IDs: WB-STRAIN:QG1, CGC_QG1
Notes: qgIR1 (X, CB4856>N2, haw102573 to 4,822,488) X. The strain is a nearly isogenic line that carries the CB4856 version of npr-1 in an otherwise N2 genetic background. NIL derived from RIAIL QX58 linked then unlinked to mec-2 from CB3273 lon-2 mec-2, then backcrossed to lon-2 for 12 generations selecting nonLon worms, then homozygosed. Genotyped N2 at pkP6106 and pkP6145. Based on QG613 sequencing, interval is from X:4,754,307-4,864,273.
Proper citation: RRID:WB-STRAIN:WBStrain00031188 Copy
http://www.wormbase.org/db/get?name=WBStrain00031113
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:37865119
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:PX174, CGC_PX174
Notes: Isolated at Devil's Lake State Park, Lincoln City, OR. Off a path about 200 feet from a dock in wet, organic topsoil in a forest.|"Made_by: Ben White"
Proper citation: RRID:WB-STRAIN:WBStrain00031113 Copy
http://www.wormbase.org/db/get?name=WBStrain00031116
Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:PX179, CGC_PX179
Notes: Isolated in northwest Hendricks Park, northwest rhododendron garden, Eugene, OR. From under rocks over damp, organic soil. Isolated from a snail.|"Made_by: Ben White"
Proper citation: RRID:WB-STRAIN:WBStrain00031116 Copy
http://www.wormbase.org/db/get?name=WBStrain00031164
Source Database: WormBase (WB)
Affected Genes: WBGene00013878(atfs-1)
Genomic Alteration: WBGene00013878(atfs-1)
Availability: available
Source References: PMID:33718883
Synonyms: atfs-1(et18) V.
Alternate IDs: WB-STRAIN:QC118, CGC_QC118
Notes: Gain-of-function atfs-1 allele. Reference: Rauthan M, et al. Proc Natl Acad Sci U S A. 2013 Apr 9;110(15):5981-6.|"WBStrain provided so WBPaper00061178 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00031164 Copy
http://www.wormbase.org/db/get?name=WBStrain00031175
Source Database: WormBase (WB)
Affected Genes: WBGene00021313(paqr-2)
Genomic Alteration: WBGene00021313(paqr-2)
Availability: available
Source References: PMID:36653384
Synonyms: paqr-2(tm3410) III.
Alternate IDs: WB-STRAIN:QC129, CGC_QC129
Notes: Mutagen:TMP+UV|"Mutagen:TMP/UV"|"Small brood size, reduced adult length, reduced locomotion and reduced life span. Maintain at 25C. Unable to grow at 15C. Withered tail-tip phenotype at 20C and 25C. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343."
Proper citation: RRID:WB-STRAIN:WBStrain00031175 Copy
http://www.wormbase.org/db/get?name=WBStrain00031273
Source Database: WormBase (WB)
Affected Genes: WBGene00004804(skn-1)
Genomic Alteration: WBGene00004804(skn-1)
Availability: available
Source References: PMID:32482227, PMID:32535316, PMID:31771413, PMID:33809299, PMID:36791646, PMID:37704756, PMID:38790689
Synonyms: skn-1(zj15) IV.
Alternate IDs: WB-STRAIN:QV225, CGC_QV225
Notes: Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.|"Reference WBPaper00059755 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype [skn-1(zj15) IV.]"
Proper citation: RRID:WB-STRAIN:WBStrain00031273 Copy
http://www.wormbase.org/db/get?name=WBStrain00031279
Source Database: WormBase (WB)
Availability: available
Source References: PMID:30078564, PMID:33820969, PMID:37221008, PMID:37572357, PMID:37865119, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:QX1211, CGC_QX1211
Notes: C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.|"Supplementary_genotype"
Proper citation: RRID:WB-STRAIN:WBStrain00031279 Copy
http://www.wormbase.org/db/get?name=WBStrain00031361
Source Database: WormBase (WB)
Affected Genes: WBGene00006406(srgp-1)
Genomic Alteration: WBGene00006406(srgp-1)
Availability: available
Source References: EMPTY
Synonyms: srgp-1(ok300) IV.
Alternate IDs: WB-STRAIN:RB570, CGC_RB570
Notes: F12F6.5. Homozygous. Outer Left Sequence: GATGTGAAGGCTGACAAGCA. Outer Right Sequence: TAACCCGTGCATTTGTTGAA. Inner Left Sequence: CTTCGAGGCCAATCATCAAT. Inner Right Sequence: GCCAAAACTATCATGGGCTG. Inner Primer PCR Length: 2904 bp. Deletion Size: 1406 bp. Deletion left flank: ttttattactttgttttatatttcaaaaac. Deletion right flank: atcaagtcgatcttcaaatcgatcaaaagc.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031361 Copy
http://www.wormbase.org/db/get?name=WBStrain00031371
Source Database: WormBase (WB)
Affected Genes: WBGene00003750(nlp-12)
Genomic Alteration: WBGene00003750(nlp-12)
Availability: available
Source References: PMID:33524034
Synonyms: nlp-12(ok335) I.
Alternate IDs: WB-STRAIN:RB607, CGC_RB607
Notes: M01D7.5. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060969 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00031371 Copy
http://www.wormbase.org/db/get?name=WBStrain00031352
Source Database: WormBase (WB)
Affected Genes: WBGene00012137(asic-2)
Genomic Alteration: WBGene00012137(asic-2)
Availability: available
Source References: PMID:37500635
Synonyms: T28F4.2(ok289) I.
Alternate IDs: WB-STRAIN:RB557, CGC_RB557
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T28F4.2. Homozygous. Outer Left Sequence: GTGTGTGTGCAAAATGGAGG. Outer Right Sequence: ATAGTCCAAGCCACAAACCG. Inner Left Sequence: ATTGAAGGTTCGCTTGTTGG. Inner Right Sequence: AGCTCGTAGCTGAGCGTTTC. Inner primer WT PCR product: 3219."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031352 Copy
http://www.wormbase.org/db/get?name=WBStrain00031350
Source Database: WormBase (WB)
Affected Genes: WBGene00003970(pek-1)
Genomic Alteration: WBGene00003970(pek-1)
Availability: available
Source References: PMID:32851977, PMID:33495210, PMID:33542359, PMID:34407398, PMID:37902464
Synonyms: pek-1(ok275) X.
Alternate IDs: WB-STRAIN:RB545, CGC_RB545
Notes: F46C3.1. Homozygous. eukaryotic initiation factor 2 alpha kinase PEK. Outer Left Sequence: ctgagccatcgacaaactca. Outer Right Sequence: ccttggtaccattcaacgct. Inner Left Sequence: ctgagaaggcaacgctctct. Inner Right Sequence: atcaccgctactctggatgg. Inner primer WT PCR product: 2967.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"Supplementary_genotype pek-1(ok275)"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060132 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060933 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061805 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00031350 Copy
http://www.wormbase.org/db/get?name=WBStrain00031329
Source Database: WormBase (WB)
Affected Genes: WBGene00000472(cey-1)
Genomic Alteration: WBGene00000472(cey-1)
Availability: available
Source References: PMID:39423228
Synonyms: cey-1(rrr12) II.
Alternate IDs: WB-STRAIN:RAF5, CGC_RAF5
Notes: Slightly pale appearance. Reference: Arnold A, et al. Nucleic Acids Res. 2014 Dec 1;42(21):13353-69.
Proper citation: RRID:WB-STRAIN:WBStrain00031329 Copy
http://www.wormbase.org/db/get?name=WBStrain00031325
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:37620393
Synonyms: unc-119(ed3) III; rrrIs1.
Alternate IDs: WB-STRAIN:RAF1, CGC_RAF1
Notes: Made_by: Biedermann/Senften|"rrrIs1 [pie-1p::GFP::Histone H2B::cye-1 3'UTR + unc-119(+)]. Slightly Unc."
Proper citation: RRID:WB-STRAIN:WBStrain00031325 Copy
http://www.wormbase.org/db/get?name=WBStrain00031383
Source Database: WormBase (WB)
Affected Genes: WBGene00004762(sel-5)
Genomic Alteration: WBGene00004762(sel-5)
Availability: available
Source References: EMPTY
Synonyms: sel-5(ok363) III.
Alternate IDs: WB-STRAIN:RB638, CGC_RB638
Notes: F35G12.3A. Homozygous. Outer Left Sequence: CACTGAGCAATTGCCTTTCA. Outer Right Sequence: ATCGCCGAAGGTAGGTTTTT. Inner Left Sequence: CAAACACATCATCCACCACC. Inner Right Sequence: TTTCTTCCAGGTGGATTTGC. Inner primer WT PCR product: 3269.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031383 Copy
http://www.wormbase.org/db/get?name=WBStrain00031398
Source Database: WormBase (WB)
Affected Genes: WBGene00001594(glc-4)
Genomic Alteration: WBGene00001594(glc-4)
Availability: available
Source References: EMPTY
Synonyms: glc-4(ok212) II.
Alternate IDs: WB-STRAIN:RB658, CGC_RB658
Notes: C27H5.8. Homozygous. Outer Left Sequence: tcagcaccttcactgattgc. Outer Right Sequence: ttcccgaccactaggtatgc. Inner Left Sequence: cgacacattgtacagacccg. Inner Right Sequence: gcacctccaccacaggttat. Inner primer WT PCR product: 3279.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031398 Copy
http://www.wormbase.org/db/get?name=WBStrain00031485
Source Database: WormBase (WB)
Affected Genes: WBGene00000222(atf-6)
Genomic Alteration: WBGene00000222(atf-6)
Availability: available
Source References: PMID:33495210, PMID:33542359, PMID:36924492, PMID:37902464, PMID:39436952
Synonyms: atf-6(ok551) X.
Alternate IDs: WB-STRAIN:RB772, CGC_RB772
Notes: F45E6.2. Homozygous. Outer Left Sequence: GGCGGGAGTTTAGGAGATTC. Outer Right Sequence: AAAGGCACGGAAATTGAGAA. Inner Left Sequence: AATGACCAGGAAATGTGGGA. Inner Right Sequence: AAGTGTCAATTGGCCAGTCC. Inner primer WT PCR product: 2983.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"Supplementary_genotype atf-6(ok551)"|"Supplementary_genotype atf-6(ok551) X"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00060933 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00031485 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.