Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00062603
Source Database: WormBase (WB)
Affected Genes: WBGene00003004(lin-15)
Genomic Alteration: WBGene00003004(lin-15)
Availability: unknown
Source References: EMPTY
Synonyms: lin-15AB(n765) X; wzIs20.
Notes: wzIs20 [lgc-55p::GFP + lin-15(+)]. lgc-55 regulatory sequences drive expression of GFP in neurons, GLR cells and some muscles. Reference: Ringstad N, et al. Science. 2009;325(5936):96-100. doi:10.1126/science.1169243
Proper citation: RRID:WB-STRAIN:WBStrain00062603 Copy
http://www.wormbase.org/db/get?name=WBStrain00062601
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00020142(aak-2)
Genomic Alteration: WBGene00006843(unc-119), WBGene00020142(aak-2)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; aak-2(ok524) X; fphIs3.
Notes: fphIs3 [rab-3p::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed from the neuronal rab-3 promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.
Proper citation: RRID:WB-STRAIN:WBStrain00062601 Copy
http://www.wormbase.org/db/get?name=WBStrain00062551
Source Database: WormBase (WB)
Affected Genes: WBGene00006687(twk-35)
Genomic Alteration: WBGene00006687(twk-35)
Availability: unknown
Source References: EMPTY
Synonyms: twk-35(mac531) V.
Notes: Made_by: Chuanman Zhou|"twk-35 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723."
Proper citation: RRID:WB-STRAIN:WBStrain00062551 Copy
http://www.wormbase.org/db/get?name=WBStrain00062555
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: rexEx7.
Notes: Made_by: SunyBiotech Co., Ltd|"rexEx7 [gpa-4p::gfp::halo + mec-7p::mRFP]. Pick fluorescent worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Green fluorescence in two ASI neurons."
Proper citation: RRID:WB-STRAIN:WBStrain00062555 Copy
http://www.wormbase.org/db/get?name=WBStrain00062559
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: dvIs19 III; rexEx11.
Notes: dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type.|"Made_by: Marcus J. C. Long"
Proper citation: RRID:WB-STRAIN:WBStrain00062559 Copy
http://www.wormbase.org/db/get?name=WBStrain00062705
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: qSi423 II.
Notes: qSi423 [gld-1p::GFP::H2B::gld-1 3'UTR(FBEa TGT to ACA & FBEa* TGT to ACA)[*rajSi50] + Cbr-unc-119(+)] II. Modification of gld-1 FBEa and FBEa* in gld-1 3'UTR of single-copy insertion transgene. Qiu et al., in preparation.
Proper citation: RRID:WB-STRAIN:WBStrain00062705 Copy
http://www.wormbase.org/db/get?name=WBStrain00062706
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: rajSi50 II; unc-119(ed3) III.
Notes: Made_by: Kathrin Theil|"rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
Proper citation: RRID:WB-STRAIN:WBStrain00062706 Copy
http://www.wormbase.org/db/get?name=WBStrain00062704
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001401(fbf-1)|WBGene00001402(fbf-2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001401(fbf-1), WBGene00001402(fbf-2)
Availability: unknown
Source References: EMPTY
Synonyms: fbf-1(ok91) fbf-2(q1291[*q973])/mIn1 [mIs14 dpy-10(e128)] II.
Notes: Made_by: Brian Carrick|"Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479E substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain."
Proper citation: RRID:WB-STRAIN:WBStrain00062704 Copy
http://www.wormbase.org/db/get?name=WBStrain00062660
Source Database: WormBase (WB)
Affected Genes: WBGene00003071(lrp-1)
Genomic Alteration: WBGene00003071(lrp-1)
Availability: unknown
Source References: EMPTY
Synonyms: lrp-1(wrd320[lrp-1::mNG::3xFLAG]) I.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in the last exon of the endogenous lrp-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062660 Copy
http://www.wormbase.org/db/get?name=WBStrain00062665
Source Database: WormBase (WB)
Affected Genes: WBGene00000602(col-13)
Genomic Alteration: WBGene00000602(col-13)
Availability: unknown
Source References: EMPTY
Synonyms: col-13(wrd344[col-13::mNG::3xFLAG]) V.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-13 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062665 Copy
http://www.wormbase.org/db/get?name=WBStrain00062662
Source Database: WormBase (WB)
Affected Genes: WBGene00000928(dbd-2)
Genomic Alteration: WBGene00000928(dbd-2)
Availability: unknown
Source References: EMPTY
Synonyms: dao-2(wrd328[dao-2::mNG::3xFLAG]) II.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dao-2 locus by CRISPR using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062662 Copy
http://www.wormbase.org/db/get?name=WBStrain00062663
Source Database: WormBase (WB)
Affected Genes: WBGene00001074(dpy-13)
Genomic Alteration: WBGene00001074(dpy-13)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-13(syb3318(wrd337[dpy-13::30x linker::mScarlet(dpi)::10x linker]) IV.
Notes: 30x linker::mScarlet(dpi)::10x linker tag inserted into the C-terminus of the endogenous dpy-13 locus by CRISPR using a Cas9 RNP. Derived by modification of syb3318[dpy-13::mNG] in parental strain PHX3318, replacing mNeonGreen with the mScarlet and linkers.
Proper citation: RRID:WB-STRAIN:WBStrain00062663 Copy
http://www.wormbase.org/db/get?name=WBStrain00062668
Source Database: WormBase (WB)
Affected Genes: WBGene00010677(gtbp-1)
Genomic Alteration: WBGene00010677(gtbp-1)
Availability: unknown
Source References: EMPTY
Synonyms: gtbp-1(ax5000[gtbp-1::tagRFP]) IV.
Notes: Made_by: Sean Lee|"tagRFP tag inserted into endogenous gtbp-1 locus. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687."
Proper citation: RRID:WB-STRAIN:WBStrain00062668 Copy
http://www.wormbase.org/db/get?name=WBStrain00062700
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001401(fbf-1)|WBGene00001402(fbf-2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001401(fbf-1), WBGene00001402(fbf-2)
Availability: unknown
Source References: EMPTY
Synonyms: fbf-1(ok91) fbf-2(q1272[*q1023])/mIn1 [mIs14 dpy-10(e128)] II.
Notes: Made_by: Brian Carrick|"Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain."
Proper citation: RRID:WB-STRAIN:WBStrain00062700 Copy
http://www.wormbase.org/db/get?name=WBStrain00062659
Source Database: WormBase (WB)
Affected Genes: WBGene00000739(col-166)
Genomic Alteration: WBGene00000739(col-166)
Availability: unknown
Source References: EMPTY
Synonyms: col-166(wrd319[col-166::mNG::3xFLAG]) X.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally to produce a translational fusion after amino acid 120 in the endogenous col-166 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062659 Copy
http://www.wormbase.org/db/get?name=WBStrain00062650
Source Database: WormBase (WB)
Affected Genes: WBGene00009384(piit-1)
Genomic Alteration: WBGene00009384(piit-1)
Availability: unknown
Source References: EMPTY
Synonyms: piit-1(wrd302[piit-1::mNG::3xFLAG]) V.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous piit-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062650 Copy
http://www.wormbase.org/db/get?name=WBStrain00062653
Source Database: WormBase (WB)
Affected Genes: WBGene00000699(col-125)
Genomic Alteration: WBGene00000699(col-125)
Availability: unknown
Source References: EMPTY
Synonyms: col-125(wrd300 wrd312[col-125::mScarlet::2xOLLAS]) IV.
Notes: linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous col-125 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd300.
Proper citation: RRID:WB-STRAIN:WBStrain00062653 Copy
http://www.wormbase.org/db/get?name=WBStrain00062652
Source Database: WormBase (WB)
Affected Genes: WBGene00013352(lon-8)
Genomic Alteration: WBGene00013352(lon-8)
Availability: unknown
Source References: EMPTY
Synonyms: lon-8(wrd305[lon-8::mNG::3xFLAG]) V.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous lon-8 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062652 Copy
http://www.wormbase.org/db/get?name=WBStrain00062657
Source Database: WormBase (WB)
Affected Genes: WBGene00013352(lon-8)
Genomic Alteration: WBGene00013352(lon-8)
Availability: unknown
Source References: EMPTY
Synonyms: lon-8(wrd305 wrd317[lon-8::mScarlet::2xOLLAS]) V.
Notes: linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous lon-8 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd305.
Proper citation: RRID:WB-STRAIN:WBStrain00062657 Copy
http://www.wormbase.org/db/get?name=WBStrain00062658
Source Database: WormBase (WB)
Affected Genes: WBGene00011522(srap-1)
Genomic Alteration: WBGene00011522(srap-1)
Availability: unknown
Source References: EMPTY
Synonyms: srap-1(wrd318[srap-1::mNG::3xFLAG]) II.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted in the first exon after the signal sequenceof the endogenous srap-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062658 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
