Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 71 showing 1401 ~ 1420 out of 122,907 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00062585

Source Database: WormBase (WB)
Affected Genes: WBGene00002246(lag-2)|WBGene00003001(lin-12)
Genomic Alteration: WBGene00002246(lag-2), WBGene00003001(lin-12)
Availability: unknown
Source References: EMPTY
Synonyms: cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V.
Notes: cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.|"Made_by: Theresa Gibney and Taylor Medwig-Kinney"

Proper citation: RRID:WB-STRAIN:WBStrain00062585 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062586

Source Database: WormBase (WB)
Affected Genes: WBGene00002246(lag-2)|WBGene00003001(lin-12)
Genomic Alteration: WBGene00002246(lag-2), WBGene00003001(lin-12)
Availability: unknown
Source References: EMPTY
Synonyms: cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V.
Notes: cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.|"Made_by: Theresa Gibney and Taylor Medwig-Kinney"

Proper citation: RRID:WB-STRAIN:WBStrain00062586 Copy   


  • RRID:WB-STRAIN:WBStrain00062625

http://www.wormbase.org/db/get?name=WBStrain00062625

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Y116F11B.14(bet83) V.
Notes: Homozygous viable. Deletion of 1493 bp in parental strain N2. Left flanking sequence: attaatttttgaatttcctaca; Right flanking sequence: tgacgggctaatattgaatta. sgRNA #1: attacactataataatgtgt; sgRNA #2: aaacgacaaactcattatga.|"Made_by: Bettinger lab"

Proper citation: RRID:WB-STRAIN:WBStrain00062625 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062622

Source Database: WormBase (WB)
Affected Genes: WBGene00022629(algn-12)
Genomic Alteration: WBGene00022629(algn-12)
Availability: unknown
Source References: EMPTY
Synonyms: algn-12(bet74) V/nT1[qls51] (IV;V).
Notes: Homozygous sterile. Balanced by nT1[qIs51]. Deletion of 3471 bp in parental strain N2. Left flanking sequence: tgatcactcacagttccctgg; Right flanking sequence: gaatggatatgatgatgtatat. sgRNA #1: atgttcgtggaacgacacca; sgRNA #2: aggataaactctctcttgaa.|"Made_by: Bettinger lab"

Proper citation: RRID:WB-STRAIN:WBStrain00062622 Copy   


  • RRID:WB-STRAIN:WBStrain00062617

http://www.wormbase.org/db/get?name=WBStrain00062617

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Y76A2B.4(bet65) III.
Notes: Homozygous viable. Deletion of 1579 bp in parental strain N2. Left flanking sequence: gcaaaaaaaaacataccaga; Right flanking sequence: cgtggtttcaggccattacg. sgRNA #1: cctcactgatgatcgtcatc; sgRNA #2: aaaggttcagcattcacacg.|"Made_by: Bettinger lab"

Proper citation: RRID:WB-STRAIN:WBStrain00062617 Copy   


  • RRID:WB-STRAIN:WBStrain00062618

http://www.wormbase.org/db/get?name=WBStrain00062618

Source Database: WormBase (WB)
Affected Genes: WBGene00016665(chil-11)
Genomic Alteration: WBGene00016665(chil-11)
Availability: unknown
Source References: EMPTY
Synonyms: chil-11(bet66) IV.
Notes: Homozygous viable. Deletion of 2532 bp in parental strain N2. Left flanking sequence: agtcaattcggaactccatgt; Right flanking sequence: tctacggtttaaacaactcctc. sgRNA #1: aacgggatctgttcatcaca; sgRNA #2: agtgtgaaacgcaacgtcta.|"Made_by: Bettinger lab"

Proper citation: RRID:WB-STRAIN:WBStrain00062618 Copy   


  • RRID:WB-STRAIN:WBStrain00062616

http://www.wormbase.org/db/get?name=WBStrain00062616

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Y67H2A.2(bet63) IV.
Notes: Homozygous viable. Deletion of 2572 bp in parental strain N2. Left flanking sequence: atctatttttttaaggccgaac; Right flanking sequence: tattggcagcaagcgttgcgaa. sgRNA #1: ccatacgttgttgtggagtt; sgRNA #2: tgtgaagcggaaaaccctat.|"Made_by: Bettinger lab"

Proper citation: RRID:WB-STRAIN:WBStrain00062616 Copy   


  • RRID:WB-STRAIN:WBStrain00062572

http://www.wormbase.org/db/get?name=WBStrain00062572

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: dmaEx617.
Notes: dmaEx617 [fshr-1p::fshr-1::GFP + unc-54p::mCherry]. Pick mCherry+ animals to maintain. Extrachromosomal fshr-1p::fshr-1::GFP translation reporter. Reference: Wang C, et al. Aging Cell. 2023 Jan;22(1):e13735. doi: 10.1111/acel.13735. PMID: 36415159.|"Made_by: Dengke Ma Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00062572 Copy   


  • RRID:WB-STRAIN:WBStrain00062576

http://www.wormbase.org/db/get?name=WBStrain00062576

Source Database: WormBase (WB)
Affected Genes: WBGene00003271(mir-43)
Genomic Alteration: WBGene00003271(mir-43)
Availability: unknown
Source References: EMPTY
Synonyms: mir-43(sjm1) II.
Notes: Homozygotes lack obvious gross phenotypes; miR-43(sjm1) accumulates in L4 larvae compared to wild-type miR-43. mir-43(sjm1) has an inversion of the miR-43 seed sequence. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna"

Proper citation: RRID:WB-STRAIN:WBStrain00062576 Copy   


  • RRID:WB-STRAIN:WBStrain00062577

http://www.wormbase.org/db/get?name=WBStrain00062577

Source Database: WormBase (WB)
Affected Genes: WBGene00003271(mir-43)
Genomic Alteration: WBGene00003271(mir-43)
Availability: unknown
Source References: EMPTY
Synonyms: mir-43(sjm2) II.
Notes: Homozygotes lack obvious gross phenotypes. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain is also homozygous for a G>T point substitution at position 8 of miR-42. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna"

Proper citation: RRID:WB-STRAIN:WBStrain00062577 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062610

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Caenorhabditis sp. 78 wild isolate.
Notes: Made_by: Marie-Anne Felix and Hagus Tarno's lab|"Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting flowers of Stewartia pseudocamellia collected near Malino, South Sulawesi, Indonesia, on 6 May 2024. GPS -5.242944, 119.868592. Reference: Devi, et al., in preparation."

Proper citation: RRID:WB-STRAIN:WBStrain00062610 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062613

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Caenorhabditis sp. 80 wild isolate.
Notes: Made_by: Marie-Anne Felix and Hagus Tarno's lab|"Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting wild Musa pseudostems collected in the forest on the road between Bromo and Malang, East Java, Indonesia, on 11 May 2024. GPS -7.99746, 112.87387. Reference: Devi, et al., in preparation."

Proper citation: RRID:WB-STRAIN:WBStrain00062613 Copy   


  • RRID:WB-STRAIN:WBStrain00062614

http://www.wormbase.org/db/get?name=WBStrain00062614

Source Database: WormBase (WB)
Affected Genes: WBGene00003625(nhr-31)
Genomic Alteration: WBGene00003625(nhr-31)
Availability: unknown
Source References: EMPTY
Synonyms: nhr-31(ye123) IV.
Notes: Made_by: Youmie Kim|"Maintain at 15C. Temperature-sensitive: slow growth rate, reduced brood size. Resistant to Cry proteins. Isolated from EMS screen in N2 background. Reference: Kim YM, et al. PLoS Pathog. 2024 Oct 18;20(10):e1012611. doi: 10.1371/journal.ppat.1012611. PMID: 39423230."

Proper citation: RRID:WB-STRAIN:WBStrain00062614 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062579

Source Database: WormBase (WB)
Affected Genes: WBGene00003271(mir-43)|WBGene00004140(ebax-1)
Genomic Alteration: WBGene00003271(mir-43), WBGene00004140(ebax-1)
Availability: unknown
Source References: EMPTY
Synonyms: mir-43(sjm1) II; ebax-1(tm2321) IV.
Notes: Homozygotes lack obvious gross phenotypes, though some miRNAs are elevated due to a loss-of-function mutation in ebax-1. mir-43(sjm1) is an inversion of the seed sequence of miR-43. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm1) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna"

Proper citation: RRID:WB-STRAIN:WBStrain00062579 Copy   


  • RRID:WB-STRAIN:WBStrain00062607

http://www.wormbase.org/db/get?name=WBStrain00062607

Source Database: WormBase (WB)
Affected Genes: WBGene00006514(tdp-1)
Genomic Alteration: WBGene00006514(tdp-1)
Availability: unknown
Source References: EMPTY
Synonyms: tdp-1(tgx58) I.
Notes: Made_by: nVivo Biosystems/ Nemametrix and Hart lab|"Null allele. CRISPR-engineered deletion of the tdp-1 locus precisely eliminates all known tdp-1 exons and introns. Reference: Lins J, et al. Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants. MicroPubl Biol. 2023 Jun 6;2023:10.17912/micropub.biology.000693. doi: 10.17912/micropub.biology.000693. PMID: 37351305."

Proper citation: RRID:WB-STRAIN:WBStrain00062607 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062604

Source Database: WormBase (WB)
Affected Genes: WBGene00001975(hmg-5)
Genomic Alteration: WBGene00001975(hmg-5)
Availability: unknown
Source References: EMPTY
Synonyms: hmg-5(xn107[hmg-5::gfp]) IV.
Notes: GFP-tagged HMG-5/TFAM labels mtDNA nucleoids. GFP tag causes a reduction in number of mtDNAs. Reference: Schwartz AZA, et al. eLife. 2022 Oct 6:11:e80396. doi: 10.7554/eLife.80396. PMID: 36200990.|"Made_by: Aaron Schwartz"

Proper citation: RRID:WB-STRAIN:WBStrain00062604 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062608

Source Database: WormBase (WB)
Affected Genes: WBGene00008266(rike-1)
Genomic Alteration: WBGene00008266(rike-1)
Availability: unknown
Source References: EMPTY
Synonyms: rike-1(syb1165) V/nT1[qIs51] (IV;V).
Notes: Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP rike-1(syb1165) homozygotes (early larval lethality). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Cheng X, et al. Autophagy. 2023 Jan;19(1):241-255. doi: 10.1080/15548627.2022.2071381. PMID: 35521960.|"Made_by: SunyBiotech"

Proper citation: RRID:WB-STRAIN:WBStrain00062608 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062609

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Caenorhabditis sp. 77 wild isolate.
Notes: Made_by: Marie-Anne Felix and Hagus Tarno's lab|"Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting banana flowers collected in a forest near Batu, East Java, Indonesia, on 28 Apr 2024. GPS -7.803387, 112.516604. Reference: Devi, et al., in preparation."

Proper citation: RRID:WB-STRAIN:WBStrain00062609 Copy   


  • RRID:WB-STRAIN:WBStrain00062562

http://www.wormbase.org/db/get?name=WBStrain00062562

Source Database: WormBase (WB)
Affected Genes: WBGene00019322(ahcy-1)
Genomic Alteration: WBGene00019322(ahcy-1)
Availability: unknown
Source References: EMPTY
Synonyms: ahcy-1(syb748) I.
Notes: ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.|"Made_by: SunyBiotech Co., Ltd"

Proper citation: RRID:WB-STRAIN:WBStrain00062562 Copy   


  • RRID:WB-STRAIN:WBStrain00062566

http://www.wormbase.org/db/get?name=WBStrain00062566

Source Database: WormBase (WB)
Affected Genes: WBGene00000601(col-12)
Genomic Alteration: WBGene00000601(col-12)
Availability: unknown
Source References: EMPTY
Synonyms: col-12::mNG(ju1932) V.
Notes: Made_by: Jennifer Gotenstein Adams|"mNG inserted at C-terminus of endogenous col-12 locus."

Proper citation: RRID:WB-STRAIN:WBStrain00062566 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X