Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00031272
Source Database: WormBase (WB)
Affected Genes: WBGene00004804(skn-1)
Genomic Alteration: WBGene00004804(skn-1)
Availability: available
Source References: EMPTY
Synonyms: dvIs19 III; skn-1(zj15) IV.
Alternate IDs: WB-STRAIN:QV224, CGC_QV224
Notes: dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.
Proper citation: RRID:WB-STRAIN:WBStrain00031272 Copy
http://www.wormbase.org/db/get?name=WBStrain00031279
Source Database: WormBase (WB)
Availability: available
Source References: PMID:30078564, PMID:33820969, PMID:37221008, PMID:37572357, PMID:37865119, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:QX1211, CGC_QX1211
Notes: C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.|"Supplementary_genotype"
Proper citation: RRID:WB-STRAIN:WBStrain00031279 Copy
http://www.wormbase.org/db/get?name=WBStrain00031281
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:QX1213
Notes: Isolated from soil underneath an orange-half staked out in the backyard of 363 Jersey St. for three days. The soil and orange bits were plated on OP50 on 27 Nov and on 29 Nov six young adult hermaphrodites were detected. Each was singled to found a line, QX1211-1216.
Proper citation: RRID:WB-STRAIN:WBStrain00031281 Copy
http://www.wormbase.org/db/get?name=WBStrain00031280
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:QX1212
Notes: Isolated from soil underneath an orange-half staked out in the backyard of 363 Jersey St. for three days. The soil and orange bits were plated on OP50 on 27 Nov and on 29 Nov six young adult hermaphrodites were detected. Each was singled to found a line, QX1211-1216.
Proper citation: RRID:WB-STRAIN:WBStrain00031280 Copy
http://www.wormbase.org/db/get?name=WBStrain00031364
Source Database: WormBase (WB)
Affected Genes: WBGene00016906(C53D5.5)
Genomic Alteration: WBGene00016906(C53D5.5)
Availability: available
Source References: EMPTY
Synonyms: C53D5.5(ok311) I.
Alternate IDs: WB-STRAIN:RB578, CGC_RB578
Notes: C53D5.5. Homozygous. Outer Left Sequence: ccagcttctagccgcataac. Outer Right Sequence: caggtctcgaaacgaccaat. Inner Left Sequence: cccgtttttcagctttgtgt. Inner Right Sequence: acgggcaatattttcggaat. Inner primer WT PCR product: 2904.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031364 Copy
http://www.wormbase.org/db/get?name=WBStrain00031361
Source Database: WormBase (WB)
Affected Genes: WBGene00006406(srgp-1)
Genomic Alteration: WBGene00006406(srgp-1)
Availability: available
Source References: EMPTY
Synonyms: srgp-1(ok300) IV.
Alternate IDs: WB-STRAIN:RB570, CGC_RB570
Notes: F12F6.5. Homozygous. Outer Left Sequence: GATGTGAAGGCTGACAAGCA. Outer Right Sequence: TAACCCGTGCATTTGTTGAA. Inner Left Sequence: CTTCGAGGCCAATCATCAAT. Inner Right Sequence: GCCAAAACTATCATGGGCTG. Inner Primer PCR Length: 2904 bp. Deletion Size: 1406 bp. Deletion left flank: ttttattactttgttttatatttcaaaaac. Deletion right flank: atcaagtcgatcttcaaatcgatcaaaagc.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031361 Copy
http://www.wormbase.org/db/get?name=WBStrain00031401
Source Database: WormBase (WB)
Affected Genes: WBGene00012379(Y1A5A.1)
Genomic Alteration: WBGene00012379(Y1A5A.1)
Availability: available
Source References: EMPTY
Synonyms: Y1A5A.1(ok414) III.
Alternate IDs: WB-STRAIN:RB661, CGC_RB661
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y1A5A.1. Homozygous. Outer Left Sequence: aggaagcacagactgggaga. Outer Right Sequence: caaatgcttccgtttccatt. Inner Left Sequence: ctgctcgtgtgtgtgtgttg. Inner Right Sequence: tcgtagcattgatcgtcgtc. Inner primer WT PCR product: 2569."
Proper citation: RRID:WB-STRAIN:WBStrain00031401 Copy
http://www.wormbase.org/db/get?name=WBStrain00031400
Source Database: WormBase (WB)
Affected Genes: WBGene00000195(arr-1)
Genomic Alteration: WBGene00000195(arr-1)
Availability: available
Source References: PMID:37310929
Synonyms: arr-1(ok401) X.
Alternate IDs: WB-STRAIN:RB660, CGC_RB660
Notes: F53H8.2. Homozygous. Outer Left Sequence: agttttatgccgctctcgaa. Outer Right Sequence: tcaattcgttccccactctc. Inner Left Sequence: caacttttccgccacataca. Inner Right Sequence: atggcggaagtttaccctct. Inner primer WT PCR product: 2402.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031400 Copy
http://www.wormbase.org/db/get?name=WBStrain00031374
Source Database: WormBase (WB)
Affected Genes: WBGene00001510(fzr-1)
Genomic Alteration: WBGene00001510(fzr-1)
Availability: available
Source References: EMPTY
Synonyms: fzr-1(ok380) II.
Alternate IDs: WB-STRAIN:RB622, CGC_RB622
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK1307.6. Superficially wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00031374 Copy
http://www.wormbase.org/db/get?name=WBStrain00031372
Source Database: WormBase (WB)
Affected Genes: WBGene00006461(tag-96)
Genomic Alteration: WBGene00006461(tag-96)
Availability: available
Source References: EMPTY
Synonyms: tag-96(ok336) IV.
Alternate IDs: WB-STRAIN:RB608, CGC_RB608
Notes: M01D7.4. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031372 Copy
http://www.wormbase.org/db/get?name=WBStrain00031371
Source Database: WormBase (WB)
Affected Genes: WBGene00003750(nlp-12)
Genomic Alteration: WBGene00003750(nlp-12)
Availability: available
Source References: PMID:33524034
Synonyms: nlp-12(ok335) I.
Alternate IDs: WB-STRAIN:RB607, CGC_RB607
Notes: M01D7.5. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060969 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00031371 Copy
http://www.wormbase.org/db/get?name=WBStrain00031378
Source Database: WormBase (WB)
Affected Genes: WBGene00005643(srp-2)
Genomic Alteration: WBGene00005643(srp-2)
Availability: available
Source References: EMPTY
Synonyms: srp-2(ok350) V.
Alternate IDs: WB-STRAIN:RB631, CGC_RB631
Notes: C05E4.1. Homozygous. Outer Left Sequence: CTTACTGCCGCAAATCTTCGCGA . Outer Right Sequence: GTTGCGTAGAACTTTCGAGCCTA. Inner Left Sequence: CACTTTATGACGGCACAAAAAAG. Inner Right Sequence: GTGTTATTCTAATTGTCTCGGAAC. Inner primer WT PCR product: 2719.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031378 Copy
http://www.wormbase.org/db/get?name=WBStrain00031380
Source Database: WormBase (WB)
Affected Genes: WBGene00008074(nkb-2)
Genomic Alteration: WBGene00008074(nkb-2)
Availability: available
Source References: EMPTY
Synonyms: C43F9.6(ok356) IV.
Alternate IDs: WB-STRAIN:RB634, CGC_RB634
Notes: C43F9.6. Homozygous. Outer Left Sequence: cggtgctgcattgtgtctat. Outer Right Sequence: tcgtactgcttgtttgcgtc. Inner Left Sequence: aaatcgttcgaaattgtggg. Inner Right Sequence: tctcgacagacggtgagttg. Inner primer WT PCR product: 2548.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031380 Copy
http://www.wormbase.org/db/get?name=WBStrain00031342
Source Database: WormBase (WB)
Affected Genes: WBGene00043986(fut-5)|WBGene00044383(T05A7.11)
Genomic Alteration: WBGene00043986(fut-5), WBGene00044383(T05A7.11)
Availability: available
Source References: EMPTY
Synonyms: T05A7.11&fut-5(ok242) II.
Alternate IDs: WB-STRAIN:RB511, CGC_RB511
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T05A7.11, T05A7.10. Homozygous. Outer Left Sequence: CAACATGTTCGGGAGTGATG. Outer Right Sequence: GCCACTCCATTTTTCGATGT. Inner Left Sequence: ACAGCAATGTCAAGCATTCG. Inner Right Sequence: ACGGGATATCAATGAGACGG. Inner Primer PCR Length: 3185 bp. Deletion Size: 1882 bp. Deletion left flank: TCGTAACTCCTTCATCATCTGGTTTCAAAT. Deletion right flank: ATGGAATATCATATCGTCGATTTTTATTGA."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031342 Copy
http://www.wormbase.org/db/get?name=WBStrain00031348
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:RB539
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00031348 Copy
http://www.wormbase.org/db/get?name=WBStrain00031347
Source Database: WormBase (WB)
Affected Genes: WBGene00016953(C55C3.3)
Genomic Alteration: WBGene00016953(C55C3.3)
Availability: available
Source References: EMPTY
Synonyms: C55C3.3(ok258) IV.
Alternate IDs: WB-STRAIN:RB526, CGC_RB526
Notes: C55C3.3. Homozygous. Outer Left Sequence: tgaatcggaaaaatcgaagg. Outer Right Sequence: gatctaccaagaatgcggga. Inner Left Sequence: caggtctcgccacgatttat. Inner Right Sequence: tttgtctgggcgaaaaattc. Inner primer WT PCR product: 3283.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031347 Copy
http://www.wormbase.org/db/get?name=WBStrain00031355
Source Database: WormBase (WB)
Affected Genes: WBGene00043981(aaim-1)
Genomic Alteration: WBGene00043981(aaim-1)
Availability: available
Source References: EMPTY
Synonyms: aaim-1(ok295) X.
Alternate IDs: WB-STRAIN:RB563, CGC_RB563
Notes: ok295 was previously described as an allele of dop-3, but is actually an allele of aaim-1 according to current gene models.|"Dopamine receptor knockout. [NOTE: (3/3/2025) ok295 was previously described as an allele of dop-3/T14E8.4, but is actually an allele of aaim-1/T14E8.4.1 according to current gene models.] Outer Left Sequence: ttgctccagcggttctagtt. Outer Right Sequence: gactgtctaagcgaccagcc. Inner Left Sequence: ttgtttgcgggtttgataca. Inner Right Sequence: agaagcacgcggtagttgat. Inner Primer PCR Length: 3254. Estimated Deletion Size: about 1000 bp."|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031355 Copy
http://www.wormbase.org/db/get?name=WBStrain00031352
Source Database: WormBase (WB)
Affected Genes: WBGene00012137(asic-2)
Genomic Alteration: WBGene00012137(asic-2)
Availability: available
Source References: PMID:37500635
Synonyms: T28F4.2(ok289) I.
Alternate IDs: WB-STRAIN:RB557, CGC_RB557
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T28F4.2. Homozygous. Outer Left Sequence: GTGTGTGTGCAAAATGGAGG. Outer Right Sequence: ATAGTCCAAGCCACAAACCG. Inner Left Sequence: ATTGAAGGTTCGCTTGTTGG. Inner Right Sequence: AGCTCGTAGCTGAGCGTTTC. Inner primer WT PCR product: 3219."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031352 Copy
http://www.wormbase.org/db/get?name=WBStrain00031351
Source Database: WormBase (WB)
Affected Genes: WBGene00000001(aap-1)
Genomic Alteration: WBGene00000001(aap-1)
Availability: available
Source References: EMPTY
Synonyms: aap-1(ok282) I.
Alternate IDs: WB-STRAIN:RB552, CGC_RB552
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y110A7A.10. Homozygous. Outer Left Sequence: GGACTCCGAGCTACTCAACG. Outer Right Sequence: ATGGGGGACAAGTGGATGTA. Inner Left Sequence: AATGAGCTTGTCGAGGAGGA. Inner Right Sequence: GGAGATGGAGAATCCCATGA. Inner primer WT PCR product: 2661."
Proper citation: RRID:WB-STRAIN:WBStrain00031351 Copy
http://www.wormbase.org/db/get?name=WBStrain00031350
Source Database: WormBase (WB)
Affected Genes: WBGene00003970(pek-1)
Genomic Alteration: WBGene00003970(pek-1)
Availability: available
Source References: PMID:32851977, PMID:33495210, PMID:33542359, PMID:34407398, PMID:37902464
Synonyms: pek-1(ok275) X.
Alternate IDs: WB-STRAIN:RB545, CGC_RB545
Notes: F46C3.1. Homozygous. eukaryotic initiation factor 2 alpha kinase PEK. Outer Left Sequence: ctgagccatcgacaaactca. Outer Right Sequence: ccttggtaccattcaacgct. Inner Left Sequence: ctgagaaggcaacgctctct. Inner Right Sequence: atcaccgctactctggatgg. Inner primer WT PCR product: 2967.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"Supplementary_genotype pek-1(ok275)"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060132 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060933 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061805 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00031350 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.