Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
QV224 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031272 | Caenorhabditis elegans | dvIs19 III; skn-1(zj15) IV. | dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29. | WBGene00004804(skn-1) | WBGene00004804(skn-1) | WB-STRAIN:WBStrain00031272 | WormBase (WB) | WB | available | WB-STRAIN:QV224, CGC_QV224 | 2026-08-15 09:31:34 | 0 | |||
|
QX1211 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031279 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.|"Supplementary_genotype" | WB-STRAIN:WBStrain00031279 | WormBase (WB) | WB | available | PMID:30078564 PMID:33820969 PMID:37221008 PMID:37572357 PMID:37865119 PMID:38564369 |
WB-STRAIN:QX1211, CGC_QX1211 | 2026-08-15 09:31:34 | 1 | ||||
|
QX1213 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031281 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Isolated from soil underneath an orange-half staked out in the backyard of 363 Jersey St. for three days. The soil and orange bits were plated on OP50 on 27 Nov and on 29 Nov six young adult hermaphrodites were detected. Each was singled to found a line, QX1211-1216. | WB-STRAIN:WBStrain00031281 | WormBase (WB) | WB | unknown | PMID:33820969 | WB-STRAIN:QX1213 | 2026-08-15 09:31:34 | 0 | ||||
|
QX1212 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031280 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Isolated from soil underneath an orange-half staked out in the backyard of 363 Jersey St. for three days. The soil and orange bits were plated on OP50 on 27 Nov and on 29 Nov six young adult hermaphrodites were detected. Each was singled to found a line, QX1211-1216. | WB-STRAIN:WBStrain00031280 | WormBase (WB) | WB | unknown | PMID:33820969 PMID:38564369 |
WB-STRAIN:QX1212 | 2026-08-15 09:31:34 | 0 | ||||
|
RB578 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031364 | Caenorhabditis elegans | C53D5.5(ok311) I. | C53D5.5. Homozygous. Outer Left Sequence: ccagcttctagccgcataac. Outer Right Sequence: caggtctcgaaacgaccaat. Inner Left Sequence: cccgtttttcagctttgtgt. Inner Right Sequence: acgggcaatattttcggaat. Inner primer WT PCR product: 2904.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016906(C53D5.5) | WBGene00016906(C53D5.5) | WB-STRAIN:WBStrain00031364 | WormBase (WB) | WB | available | WB-STRAIN:RB578, CGC_RB578 | 2026-08-15 09:31:36 | 0 | |||
|
RB570 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031361 | Caenorhabditis elegans | srgp-1(ok300) IV. | F12F6.5. Homozygous. Outer Left Sequence: GATGTGAAGGCTGACAAGCA. Outer Right Sequence: TAACCCGTGCATTTGTTGAA. Inner Left Sequence: CTTCGAGGCCAATCATCAAT. Inner Right Sequence: GCCAAAACTATCATGGGCTG. Inner Primer PCR Length: 2904 bp. Deletion Size: 1406 bp. Deletion left flank: ttttattactttgttttatatttcaaaaac. Deletion right flank: atcaagtcgatcttcaaatcgatcaaaagc.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006406(srgp-1) | WBGene00006406(srgp-1) | WB-STRAIN:WBStrain00031361 | WormBase (WB) | WB | available | WB-STRAIN:RB570, CGC_RB570 | 2026-08-15 09:31:36 | 1 | |||
|
RB661 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031401 | Caenorhabditis elegans | Y1A5A.1(ok414) III. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y1A5A.1. Homozygous. Outer Left Sequence: aggaagcacagactgggaga. Outer Right Sequence: caaatgcttccgtttccatt. Inner Left Sequence: ctgctcgtgtgtgtgtgttg. Inner Right Sequence: tcgtagcattgatcgtcgtc. Inner primer WT PCR product: 2569." | WBGene00012379(Y1A5A.1) | WBGene00012379(Y1A5A.1) | WB-STRAIN:WBStrain00031401 | WormBase (WB) | WB | available | WB-STRAIN:RB661, CGC_RB661 | 2026-08-15 09:31:36 | 0 | |||
|
RB660 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031400 | Caenorhabditis elegans | arr-1(ok401) X. | F53H8.2. Homozygous. Outer Left Sequence: agttttatgccgctctcgaa. Outer Right Sequence: tcaattcgttccccactctc. Inner Left Sequence: caacttttccgccacataca. Inner Right Sequence: atggcggaagtttaccctct. Inner primer WT PCR product: 2402.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000195(arr-1) | WBGene00000195(arr-1) | WB-STRAIN:WBStrain00031400 | WormBase (WB) | WB | available | PMID:37310929 | WB-STRAIN:RB660, CGC_RB660 | 2026-08-15 09:31:36 | 0 | ||
|
RB622 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031374 | Caenorhabditis elegans | fzr-1(ok380) II. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK1307.6. Superficially wild type." | WBGene00001510(fzr-1) | WBGene00001510(fzr-1) | WB-STRAIN:WBStrain00031374 | WormBase (WB) | WB | available | WB-STRAIN:RB622, CGC_RB622 | 2026-08-15 09:31:36 | 0 | |||
|
RB608 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031372 | Caenorhabditis elegans | tag-96(ok336) IV. | M01D7.4. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006461(tag-96) | WBGene00006461(tag-96) | WB-STRAIN:WBStrain00031372 | WormBase (WB) | WB | available | WB-STRAIN:RB608, CGC_RB608 | 2026-08-15 09:31:36 | 0 | |||
|
RB607 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031371 | Caenorhabditis elegans | nlp-12(ok335) I. | M01D7.5. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060969 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data." | WBGene00003750(nlp-12) | WBGene00003750(nlp-12) | WB-STRAIN:WBStrain00031371 | WormBase (WB) | WB | available | PMID:33524034 | WB-STRAIN:RB607, CGC_RB607 | 2026-08-15 09:31:36 | 3 | ||
|
RB631 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031378 | Caenorhabditis elegans | srp-2(ok350) V. | C05E4.1. Homozygous. Outer Left Sequence: CTTACTGCCGCAAATCTTCGCGA . Outer Right Sequence: GTTGCGTAGAACTTTCGAGCCTA. Inner Left Sequence: CACTTTATGACGGCACAAAAAAG. Inner Right Sequence: GTGTTATTCTAATTGTCTCGGAAC. Inner primer WT PCR product: 2719.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00005643(srp-2) | WBGene00005643(srp-2) | WB-STRAIN:WBStrain00031378 | WormBase (WB) | WB | available | WB-STRAIN:RB631, CGC_RB631 | 2026-08-15 09:31:36 | 0 | |||
|
RB634 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031380 | Caenorhabditis elegans | C43F9.6(ok356) IV. | C43F9.6. Homozygous. Outer Left Sequence: cggtgctgcattgtgtctat. Outer Right Sequence: tcgtactgcttgtttgcgtc. Inner Left Sequence: aaatcgttcgaaattgtggg. Inner Right Sequence: tctcgacagacggtgagttg. Inner primer WT PCR product: 2548.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008074(nkb-2) | WBGene00008074(nkb-2) | WB-STRAIN:WBStrain00031380 | WormBase (WB) | WB | available | WB-STRAIN:RB634, CGC_RB634 | 2026-08-15 09:31:36 | 0 | |||
|
RB511 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031342 | Caenorhabditis elegans | T05A7.11&fut-5(ok242) II. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T05A7.11, T05A7.10. Homozygous. Outer Left Sequence: CAACATGTTCGGGAGTGATG. Outer Right Sequence: GCCACTCCATTTTTCGATGT. Inner Left Sequence: ACAGCAATGTCAAGCATTCG. Inner Right Sequence: ACGGGATATCAATGAGACGG. Inner Primer PCR Length: 3185 bp. Deletion Size: 1882 bp. Deletion left flank: TCGTAACTCCTTCATCATCTGGTTTCAAAT. Deletion right flank: ATGGAATATCATATCGTCGATTTTTATTGA."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00043986(fut-5)|WBGene00044383(T05A7.11) | WBGene00043986(fut-5), WBGene00044383(T05A7.11) | WB-STRAIN:WBStrain00031342 | WormBase (WB) | WB | available | WB-STRAIN:RB511, CGC_RB511 | 2026-08-15 09:31:35 | 0 | |||
|
RB539 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031348 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00031348 | WormBase (WB) | WB | unknown | WB-STRAIN:RB539 | 2026-08-15 09:31:35 | 0 | |||||
|
RB526 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031347 | Caenorhabditis elegans | C55C3.3(ok258) IV. | C55C3.3. Homozygous. Outer Left Sequence: tgaatcggaaaaatcgaagg. Outer Right Sequence: gatctaccaagaatgcggga. Inner Left Sequence: caggtctcgccacgatttat. Inner Right Sequence: tttgtctgggcgaaaaattc. Inner primer WT PCR product: 3283.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016953(C55C3.3) | WBGene00016953(C55C3.3) | WB-STRAIN:WBStrain00031347 | WormBase (WB) | WB | available | WB-STRAIN:RB526, CGC_RB526 | 2026-08-15 09:31:35 | 0 | |||
|
RB563 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031355 | Caenorhabditis elegans | aaim-1(ok295) X. | ok295 was previously described as an allele of dop-3, but is actually an allele of aaim-1 according to current gene models.|"Dopamine receptor knockout. [NOTE: (3/3/2025) ok295 was previously described as an allele of dop-3/T14E8.4, but is actually an allele of aaim-1/T14E8.4.1 according to current gene models.] Outer Left Sequence: ttgctccagcggttctagtt. Outer Right Sequence: gactgtctaagcgaccagcc. Inner Left Sequence: ttgtttgcgggtttgataca. Inner Right Sequence: agaagcacgcggtagttgat. Inner Primer PCR Length: 3254. Estimated Deletion Size: about 1000 bp."|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00043981(aaim-1) | WBGene00043981(aaim-1) | WB-STRAIN:WBStrain00031355 | WormBase (WB) | WB | available | WB-STRAIN:RB563, CGC_RB563 | 2026-08-15 09:31:35 | 0 | |||
|
RB557 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031352 | Caenorhabditis elegans | T28F4.2(ok289) I. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T28F4.2. Homozygous. Outer Left Sequence: GTGTGTGTGCAAAATGGAGG. Outer Right Sequence: ATAGTCCAAGCCACAAACCG. Inner Left Sequence: ATTGAAGGTTCGCTTGTTGG. Inner Right Sequence: AGCTCGTAGCTGAGCGTTTC. Inner primer WT PCR product: 3219."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00012137(asic-2) | WBGene00012137(asic-2) | WB-STRAIN:WBStrain00031352 | WormBase (WB) | WB | available | PMID:37500635 | WB-STRAIN:RB557, CGC_RB557 | 2026-08-15 09:31:35 | 1 | ||
|
RB552 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031351 | Caenorhabditis elegans | aap-1(ok282) I. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y110A7A.10. Homozygous. Outer Left Sequence: GGACTCCGAGCTACTCAACG. Outer Right Sequence: ATGGGGGACAAGTGGATGTA. Inner Left Sequence: AATGAGCTTGTCGAGGAGGA. Inner Right Sequence: GGAGATGGAGAATCCCATGA. Inner primer WT PCR product: 2661." | WBGene00000001(aap-1) | WBGene00000001(aap-1) | WB-STRAIN:WBStrain00031351 | WormBase (WB) | WB | available | WB-STRAIN:RB552, CGC_RB552 | 2026-08-15 09:31:35 | 0 | |||
|
RB545 Resource Report Resource Website 10+ mentions |
RRID:WB-STRAIN:WBStrain00031350 | Caenorhabditis elegans | pek-1(ok275) X. | F46C3.1. Homozygous. eukaryotic initiation factor 2 alpha kinase PEK. Outer Left Sequence: ctgagccatcgacaaactca. Outer Right Sequence: ccttggtaccattcaacgct. Inner Left Sequence: ctgagaaggcaacgctctct. Inner Right Sequence: atcaccgctactctggatgg. Inner primer WT PCR product: 2967.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"Supplementary_genotype pek-1(ok275)"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060132 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060933 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061805 paper added based on AFP_Strain data." | WBGene00003970(pek-1) | WBGene00003970(pek-1) | WB-STRAIN:WBStrain00031350 | WormBase (WB) | WB | available | PMID:32851977 PMID:33495210 PMID:33542359 PMID:34407398 PMID:37902464 |
WB-STRAIN:RB545, CGC_RB545 | 2026-08-15 09:31:35 | 18 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
