Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
QV224
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031272 Caenorhabditis elegans dvIs19 III; skn-1(zj15) IV. dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29. WBGene00004804(skn-1) WBGene00004804(skn-1) WB-STRAIN:WBStrain00031272 WormBase (WB) WB available WB-STRAIN:QV224, CGC_QV224 2026-08-15 09:31:34 0
QX1211
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00031279 Caenorhabditis elegans Caenorhabditis elegans wild isolate. C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.|"Supplementary_genotype" WB-STRAIN:WBStrain00031279 WormBase (WB) WB available PMID:30078564
PMID:33820969
PMID:37221008
PMID:37572357
PMID:37865119
PMID:38564369
WB-STRAIN:QX1211, CGC_QX1211 2026-08-15 09:31:34 1
QX1213
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031281 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Isolated from soil underneath an orange-half staked out in the backyard of 363 Jersey St. for three days. The soil and orange bits were plated on OP50 on 27 Nov and on 29 Nov six young adult hermaphrodites were detected. Each was singled to found a line, QX1211-1216. WB-STRAIN:WBStrain00031281 WormBase (WB) WB unknown PMID:33820969 WB-STRAIN:QX1213 2026-08-15 09:31:34 0
QX1212
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031280 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Isolated from soil underneath an orange-half staked out in the backyard of 363 Jersey St. for three days. The soil and orange bits were plated on OP50 on 27 Nov and on 29 Nov six young adult hermaphrodites were detected. Each was singled to found a line, QX1211-1216. WB-STRAIN:WBStrain00031280 WormBase (WB) WB unknown PMID:33820969
PMID:38564369
WB-STRAIN:QX1212 2026-08-15 09:31:34 0
RB578
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031364 Caenorhabditis elegans C53D5.5(ok311) I. C53D5.5. Homozygous. Outer Left Sequence: ccagcttctagccgcataac. Outer Right Sequence: caggtctcgaaacgaccaat. Inner Left Sequence: cccgtttttcagctttgtgt. Inner Right Sequence: acgggcaatattttcggaat. Inner primer WT PCR product: 2904.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00016906(C53D5.5) WBGene00016906(C53D5.5) WB-STRAIN:WBStrain00031364 WormBase (WB) WB available WB-STRAIN:RB578, CGC_RB578 2026-08-15 09:31:36 0
RB570
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00031361 Caenorhabditis elegans srgp-1(ok300) IV. F12F6.5. Homozygous. Outer Left Sequence: GATGTGAAGGCTGACAAGCA. Outer Right Sequence: TAACCCGTGCATTTGTTGAA. Inner Left Sequence: CTTCGAGGCCAATCATCAAT. Inner Right Sequence: GCCAAAACTATCATGGGCTG. Inner Primer PCR Length: 2904 bp. Deletion Size: 1406 bp. Deletion left flank: ttttattactttgttttatatttcaaaaac. Deletion right flank: atcaagtcgatcttcaaatcgatcaaaagc.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006406(srgp-1) WBGene00006406(srgp-1) WB-STRAIN:WBStrain00031361 WormBase (WB) WB available WB-STRAIN:RB570, CGC_RB570 2026-08-15 09:31:36 1
RB661
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031401 Caenorhabditis elegans Y1A5A.1(ok414) III. Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y1A5A.1. Homozygous. Outer Left Sequence: aggaagcacagactgggaga. Outer Right Sequence: caaatgcttccgtttccatt. Inner Left Sequence: ctgctcgtgtgtgtgtgttg. Inner Right Sequence: tcgtagcattgatcgtcgtc. Inner primer WT PCR product: 2569." WBGene00012379(Y1A5A.1) WBGene00012379(Y1A5A.1) WB-STRAIN:WBStrain00031401 WormBase (WB) WB available WB-STRAIN:RB661, CGC_RB661 2026-08-15 09:31:36 0
RB660
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031400 Caenorhabditis elegans arr-1(ok401) X. F53H8.2. Homozygous. Outer Left Sequence: agttttatgccgctctcgaa. Outer Right Sequence: tcaattcgttccccactctc. Inner Left Sequence: caacttttccgccacataca. Inner Right Sequence: atggcggaagtttaccctct. Inner primer WT PCR product: 2402.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000195(arr-1) WBGene00000195(arr-1) WB-STRAIN:WBStrain00031400 WormBase (WB) WB available PMID:37310929 WB-STRAIN:RB660, CGC_RB660 2026-08-15 09:31:36 0
RB622
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031374 Caenorhabditis elegans fzr-1(ok380) II. Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK1307.6. Superficially wild type." WBGene00001510(fzr-1) WBGene00001510(fzr-1) WB-STRAIN:WBStrain00031374 WormBase (WB) WB available WB-STRAIN:RB622, CGC_RB622 2026-08-15 09:31:36 0
RB608
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031372 Caenorhabditis elegans tag-96(ok336) IV. M01D7.4. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006461(tag-96) WBGene00006461(tag-96) WB-STRAIN:WBStrain00031372 WormBase (WB) WB available WB-STRAIN:RB608, CGC_RB608 2026-08-15 09:31:36 0
RB607
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00031371 Caenorhabditis elegans nlp-12(ok335) I. M01D7.5. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060969 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data." WBGene00003750(nlp-12) WBGene00003750(nlp-12) WB-STRAIN:WBStrain00031371 WormBase (WB) WB available PMID:33524034 WB-STRAIN:RB607, CGC_RB607 2026-08-15 09:31:36 3
RB631
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031378 Caenorhabditis elegans srp-2(ok350) V. C05E4.1. Homozygous. Outer Left Sequence: CTTACTGCCGCAAATCTTCGCGA . Outer Right Sequence: GTTGCGTAGAACTTTCGAGCCTA. Inner Left Sequence: CACTTTATGACGGCACAAAAAAG. Inner Right Sequence: GTGTTATTCTAATTGTCTCGGAAC. Inner primer WT PCR product: 2719.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00005643(srp-2) WBGene00005643(srp-2) WB-STRAIN:WBStrain00031378 WormBase (WB) WB available WB-STRAIN:RB631, CGC_RB631 2026-08-15 09:31:36 0
RB634
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031380 Caenorhabditis elegans C43F9.6(ok356) IV. C43F9.6. Homozygous. Outer Left Sequence: cggtgctgcattgtgtctat. Outer Right Sequence: tcgtactgcttgtttgcgtc. Inner Left Sequence: aaatcgttcgaaattgtggg. Inner Right Sequence: tctcgacagacggtgagttg. Inner primer WT PCR product: 2548.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00008074(nkb-2) WBGene00008074(nkb-2) WB-STRAIN:WBStrain00031380 WormBase (WB) WB available WB-STRAIN:RB634, CGC_RB634 2026-08-15 09:31:36 0
RB511
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031342 Caenorhabditis elegans T05A7.11&fut-5(ok242) II. Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T05A7.11, T05A7.10. Homozygous. Outer Left Sequence: CAACATGTTCGGGAGTGATG. Outer Right Sequence: GCCACTCCATTTTTCGATGT. Inner Left Sequence: ACAGCAATGTCAAGCATTCG. Inner Right Sequence: ACGGGATATCAATGAGACGG. Inner Primer PCR Length: 3185 bp. Deletion Size: 1882 bp. Deletion left flank: TCGTAACTCCTTCATCATCTGGTTTCAAAT. Deletion right flank: ATGGAATATCATATCGTCGATTTTTATTGA."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00043986(fut-5)|WBGene00044383(T05A7.11) WBGene00043986(fut-5), WBGene00044383(T05A7.11) WB-STRAIN:WBStrain00031342 WormBase (WB) WB available WB-STRAIN:RB511, CGC_RB511 2026-08-15 09:31:35 0
RB539
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031348 Caenorhabditis elegans EMPTY EMPTY WB-STRAIN:WBStrain00031348 WormBase (WB) WB unknown WB-STRAIN:RB539 2026-08-15 09:31:35 0
RB526
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031347 Caenorhabditis elegans C55C3.3(ok258) IV. C55C3.3. Homozygous. Outer Left Sequence: tgaatcggaaaaatcgaagg. Outer Right Sequence: gatctaccaagaatgcggga. Inner Left Sequence: caggtctcgccacgatttat. Inner Right Sequence: tttgtctgggcgaaaaattc. Inner primer WT PCR product: 3283.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00016953(C55C3.3) WBGene00016953(C55C3.3) WB-STRAIN:WBStrain00031347 WormBase (WB) WB available WB-STRAIN:RB526, CGC_RB526 2026-08-15 09:31:35 0
RB563
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031355 Caenorhabditis elegans aaim-1(ok295) X. ok295 was previously described as an allele of dop-3, but is actually an allele of aaim-1 according to current gene models.|"Dopamine receptor knockout. [NOTE: (3/3/2025) ok295 was previously described as an allele of dop-3/T14E8.4, but is actually an allele of aaim-1/T14E8.4.1 according to current gene models.] Outer Left Sequence: ttgctccagcggttctagtt. Outer Right Sequence: gactgtctaagcgaccagcc. Inner Left Sequence: ttgtttgcgggtttgataca. Inner Right Sequence: agaagcacgcggtagttgat. Inner Primer PCR Length: 3254. Estimated Deletion Size: about 1000 bp."|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00043981(aaim-1) WBGene00043981(aaim-1) WB-STRAIN:WBStrain00031355 WormBase (WB) WB available WB-STRAIN:RB563, CGC_RB563 2026-08-15 09:31:35 0
RB557
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00031352 Caenorhabditis elegans T28F4.2(ok289) I. Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T28F4.2. Homozygous. Outer Left Sequence: GTGTGTGTGCAAAATGGAGG. Outer Right Sequence: ATAGTCCAAGCCACAAACCG. Inner Left Sequence: ATTGAAGGTTCGCTTGTTGG. Inner Right Sequence: AGCTCGTAGCTGAGCGTTTC. Inner primer WT PCR product: 3219."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00012137(asic-2) WBGene00012137(asic-2) WB-STRAIN:WBStrain00031352 WormBase (WB) WB available PMID:37500635 WB-STRAIN:RB557, CGC_RB557 2026-08-15 09:31:35 1
RB552
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031351 Caenorhabditis elegans aap-1(ok282) I. Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y110A7A.10. Homozygous. Outer Left Sequence: GGACTCCGAGCTACTCAACG. Outer Right Sequence: ATGGGGGACAAGTGGATGTA. Inner Left Sequence: AATGAGCTTGTCGAGGAGGA. Inner Right Sequence: GGAGATGGAGAATCCCATGA. Inner primer WT PCR product: 2661." WBGene00000001(aap-1) WBGene00000001(aap-1) WB-STRAIN:WBStrain00031351 WormBase (WB) WB available WB-STRAIN:RB552, CGC_RB552 2026-08-15 09:31:35 0
RB545
 
Resource Report
Resource Website
10+ mentions
RRID:WB-STRAIN:WBStrain00031350 Caenorhabditis elegans pek-1(ok275) X. F46C3.1. Homozygous. eukaryotic initiation factor 2 alpha kinase PEK. Outer Left Sequence: ctgagccatcgacaaactca. Outer Right Sequence: ccttggtaccattcaacgct. Inner Left Sequence: ctgagaaggcaacgctctct. Inner Right Sequence: atcaccgctactctggatgg. Inner primer WT PCR product: 2967.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"Supplementary_genotype pek-1(ok275)"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060132 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060933 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061805 paper added based on AFP_Strain data." WBGene00003970(pek-1) WBGene00003970(pek-1) WB-STRAIN:WBStrain00031350 WormBase (WB) WB available PMID:32851977
PMID:33495210
PMID:33542359
PMID:34407398
PMID:37902464
WB-STRAIN:RB545, CGC_RB545 2026-08-15 09:31:35 18

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.