Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00062544
Source Database: WormBase (WB)
Affected Genes: WBGene00017978(msrp-1)
Genomic Alteration: WBGene00017978(msrp-1)
Availability: unknown
Source References: EMPTY
Synonyms: Cbr-msrp-1(nm86) nmDf3 I; mfIs29.
Notes: Made_by: Asan Turdiev|"mfIs29 [Cel-lip-1::GFP + Cel-myo-2::GFP]. Strong GFP expression in pharynx and weak GFP expression in various somatic and germline tissues. nmDf3 is an 8411 bp deletion that removes Cbr-msrp-2, Cbr-msrp-3, Cbr-msrp-4, Cbr-msrp-6, and Cbr-msrp-6. Removal of all six Cbr-msrp paralogs has no apparent reproductive phenotypes. [NOTE: Van Goor J, et al. (2005) incorrectly described the nmDf3 as a 5807 bp deletion.] To confirm presence of nm86 mutation, use primers AT130+AT131 (WT: 184 nt, nm86: 224 nt). AT130: CGAAATAATTGAACCTACCAAGA. AT131: CACTCTCTCTGACTGCAAACG. To confirm presence of deletion, use primers AT72+AT73 (WT: 11213 nt, nmDf3: 2802) and AT20+AT75 (WT: 855 nt, nmDf3: no product). AT72: GTACGACGGATAGAGTGTGAT. AT73: CTGTGGGATTATGAAAAGACTC. AT20: AAAAGTAAAACATACCGATCACA. AT75: CAGCAGCAACCTTAGAACAT. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7."
Proper citation: RRID:WB-STRAIN:WBStrain00062544 Copy
http://www.wormbase.org/db/get?name=WBStrain00062548
Source Database: WormBase (WB)
Affected Genes: WBGene00006679(twk-26)
Genomic Alteration: WBGene00006679(twk-26)
Availability: unknown
Source References: EMPTY
Synonyms: twk-26(mac525) X.
Notes: Made_by: Chuanman Zhou|"twk-26 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723."
Proper citation: RRID:WB-STRAIN:WBStrain00062548 Copy
http://www.wormbase.org/db/get?name=WBStrain00062546
Source Database: WormBase (WB)
Affected Genes: WBGene00006662(twk-7)
Genomic Alteration: WBGene00006662(twk-7)
Availability: unknown
Source References: EMPTY
Synonyms: twk-7(mac510) III.
Notes: Made_by: Chuanman Zhou|"twk-7 loss-of-function allele. Hyperactive forward locomotion. twk-7(mac510) is a 10-bp deletion and 2-bp insertion in exon 9, causing a frameshift: aatttattttcagGTAAAAAAGAACGCAGCAACGGAGACATGGACATTTTCATCGTCCATTTTCTTTGCCGTAACCGTCGTCACTACCATCGGATACGGTAATCCAGTTCCAGTGACAAACATTGGACGGATATGGTGTATATTGTTCTCCTTGCTTGGAA(TACCTCTAAC)del(AA)insACTGGTTACCATCGCTGACTTGGgtaagtgg. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723."
Proper citation: RRID:WB-STRAIN:WBStrain00062546 Copy
http://www.wormbase.org/db/get?name=WBStrain00062539
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: nmIs11.
Notes: Made_by: Justin Van Goor|"nmIs11 [Cbr-msrp-3(+) + Cbr-unc-119(+) + myo-2::GFP]. GFP expression in pharynx. Wild-type (non-Unc) movement. Roughly two-fold over-expression of Cbr-msrp-3(+); has no measurable effect on fertility. Cbr-MSRP-3 is a sperm surface glycoprotein with homologs in C. elegans and other species. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7."
Proper citation: RRID:WB-STRAIN:WBStrain00062539 Copy
http://www.wormbase.org/db/get?name=WBStrain00062637
Source Database: WormBase (WB)
Affected Genes: WBGene00000603(col-14)
Genomic Alteration: WBGene00000603(col-14)
Availability: unknown
Source References: EMPTY
Synonyms: col-14(wrd271[col-14::mNG::3xFLAG]) IV.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-14 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062637 Copy
http://www.wormbase.org/db/get?name=WBStrain00062592
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: oxIs609 X.
Notes: oxIs609 [acr-5p::GAP-43::GFP + lin-15(+)] X. GFP localized to axonal membranes of acr-5 expressing neurons. acr-5 promoter drives expression of reporter containing 40 aa myristoylation sequence of GAP43 fused to GFP. oxIs609 was generated by X-ray integration of oxEx81in N2 background. Reference: Rawson RL, et al. Curr Biol. 2014 Mar 31;24(7):760-5. doi: 10.1016/j.cub.2014.02.025. PMID: 24631238.
Proper citation: RRID:WB-STRAIN:WBStrain00062592 Copy
http://www.wormbase.org/db/get?name=WBStrain00062593
Source Database: WormBase (WB)
Affected Genes: WBGene00004873(smc-3)
Genomic Alteration: WBGene00004873(smc-3)
Availability: unknown
Source References: EMPTY
Synonyms: ieSi57 II; smc-3(syb5520[smc-3::GGGGS::AID::emGFP]) III.
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. Degron and emGFP tag inserted into endogenous smc-3 locus. Derived by crossing parental strains PHX5520 with CA1200. Reference: https:|"Made_by: Jun Kim"
Proper citation: RRID:WB-STRAIN:WBStrain00062593 Copy
http://www.wormbase.org/db/get?name=WBStrain00062631
Source Database: WormBase (WB)
Affected Genes: WBGene00001075(dpy-14)
Genomic Alteration: WBGene00001075(dpy-14)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-14(wrd229[dpy-14::mNG::3xFLAG]) I.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dpy-14 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062631 Copy
http://www.wormbase.org/db/get?name=WBStrain00062599
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00020142(aak-2)
Genomic Alteration: WBGene00006843(unc-119), WBGene00020142(aak-2)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; aak-2(ok524) X; fphEx3.
Notes: fphEx3 [aak-2Ap::aak-2C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2c isoform expressed from the aak-2a promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.
Proper citation: RRID:WB-STRAIN:WBStrain00062599 Copy
http://www.wormbase.org/db/get?name=WBStrain00062632
Source Database: WormBase (WB)
Affected Genes: WBGene00004398(rol-8)
Genomic Alteration: WBGene00004398(rol-8)
Availability: unknown
Source References: EMPTY
Synonyms: rol-8(wrd230[rol-8mNG::3xFLAG]) II.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous rol-8 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062632 Copy
http://www.wormbase.org/db/get?name=WBStrain00062596
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00020142(aak-2)
Genomic Alteration: WBGene00006843(unc-119), WBGene00020142(aak-2)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; aak-2(ok524) X; fphIs1.
Notes: fphIs1 [aak-2Ap::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed with its own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.
Proper citation: RRID:WB-STRAIN:WBStrain00062596 Copy
http://www.wormbase.org/db/get?name=WBStrain00062597
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00020142(aak-2)
Genomic Alteration: WBGene00006843(unc-119), WBGene00020142(aak-2)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; aak-2(ok524) X; fphEx1.
Notes: fphEx1 [aak-2Cp::aak-2C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2C isoform expressed from its own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.
Proper citation: RRID:WB-STRAIN:WBStrain00062597 Copy
http://www.wormbase.org/db/get?name=WBStrain00062630
Source Database: WormBase (WB)
Affected Genes: WBGene00001066(dpy-4)
Genomic Alteration: WBGene00001066(dpy-4)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-4(wrd228[dpy-4::mNG::3xFLAG]) IV.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dpy-4 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062630 Copy
http://www.wormbase.org/db/get?name=WBStrain00062635
Source Database: WormBase (WB)
Affected Genes: WBGene00009983(cut-2)
Genomic Alteration: WBGene00009983(cut-2)
Availability: unknown
Source References: EMPTY
Synonyms: cut-2(wrd233[cut-2::mNG::3xFLAG]) V.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous cut-2 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062635 Copy
http://www.wormbase.org/db/get?name=WBStrain00062628
Source Database: WormBase (WB)
Affected Genes: WBGene00003553(nas-37)
Genomic Alteration: WBGene00003553(nas-37)
Availability: unknown
Source References: EMPTY
Synonyms: nas-37(wrd106[nas-37:::mNG::3xFLAG]) X.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous nas-37 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062628 Copy
http://www.wormbase.org/db/get?name=WBStrain00062629
Source Database: WormBase (WB)
Affected Genes: WBGene00000788(cpz-1)
Genomic Alteration: WBGene00000788(cpz-1)
Availability: unknown
Source References: EMPTY
Synonyms: cpz-1(wrd128[cpz-1::mNG::3xFLAG::linker]) I.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 4 of the endogenous cpz-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
Proper citation: RRID:WB-STRAIN:WBStrain00062629 Copy
http://www.wormbase.org/db/get?name=WBStrain00062626
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: K02D10.1(bet88) III.
Notes: Homozygous viable. Deletion of 2796 bp in parental strain N2. Left flanking sequence: tatgaactttaagaccaact; Right flanking sequence: ggatgggatgcaactgttgc. sgRNA #1: actcatactataagttcagt; sgRNA #2: ctacttgggcaaagccagga.|"Made_by: Bettinger lab"
Proper citation: RRID:WB-STRAIN:WBStrain00062626 Copy
http://www.wormbase.org/db/get?name=WBStrain00062580
Source Database: WormBase (WB)
Affected Genes: WBGene00003271(mir-43)|WBGene00004140(ebax-1)
Genomic Alteration: WBGene00003271(mir-43), WBGene00004140(ebax-1)
Availability: unknown
Source References: EMPTY
Synonyms: mir-43(sjm2) II; ebax-1(tm2321) IV.
Notes: Homozygotes lack gross phenotypes, though some miRNAs are elevated due to loss-of-function mutation in ebax-1. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain also has a G>T point substitution at position 8 of miR-42. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm2) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna"
Proper citation: RRID:WB-STRAIN:WBStrain00062580 Copy
http://www.wormbase.org/db/get?name=WBStrain00062583
Source Database: WormBase (WB)
Affected Genes: WBGene00002246(lag-2)|WBGene00003001(lin-12)
Genomic Alteration: WBGene00002246(lag-2), WBGene00003001(lin-12)
Availability: unknown
Source References: EMPTY
Synonyms: cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V.
Notes: cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.|"Made_by: Taylor Medwig-Kinney and Theresa Gibney"
Proper citation: RRID:WB-STRAIN:WBStrain00062583 Copy
http://www.wormbase.org/db/get?name=WBStrain00062582
Source Database: WormBase (WB)
Affected Genes: WBGene00002246(lag-2)|WBGene00003001(lin-12)
Genomic Alteration: WBGene00002246(lag-2), WBGene00003001(lin-12)
Availability: unknown
Source References: EMPTY
Synonyms: lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V.
Notes: Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.|"Made_by: Taylor Medwig-Kinney and Ariel Pani"
Proper citation: RRID:WB-STRAIN:WBStrain00062582 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
