Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
gln-3(ve959[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063058 | Caenorhabditis elegans | gln-3(ve959[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 2417 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCGGTCTCGTGGAGTCCGGTCAAACGACGC ; Right flanking sequence: ACCTGCTTGTCGGTGGCGAATTGACTGCGG. gln-3 sgRNA A: TCGTTGTCTTTTCCACCGTG; gln-3 sgRNA B: CCTGCAAAAGTTCCTGAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00001604(gln-3)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001604(gln-3), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063058 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:13 | 0 | ||||
|
rnp-7(ve940[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063040 | Caenorhabditis elegans | rnp-7(ve940[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. | Made_by: RG KO Group|"qIs26 [lag-2::GFP + rol-6(su1006)] III. Maintain by picking GFP+ Rollers (GFP expression in both pharynx and distal tip cells). Heterozygotes are Rol GFP+ (GFP expression in both pharynx and distal tip cells), and segregate Rol GFP+ (GFP expression in both pharynx and distal tip cells), non-Rol GFP+ (GFP only in pharynx) ve940 homozygotes (Unc, arrest as larvae with a curled tail). qC1[qIs26] is homozygous lethal (unknown stage). Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCTTCGATATCCACCACCGGATCCTCCA; Right flanking sequence: TGGAAGATATTGCACTGGTGGTCGTGCTTC. rnp-7 sgRNA A: GGAAGCCGATACAGTACAGG; rnp-7 sgRNA B: ACTAGTAGGTCCTGGCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00003514(myo-2)|WBGene00004390(rnp-7)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00003514(myo-2), WBGene00004390(rnp-7), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063040 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:13 | 0 | ||||
|
T02C1.2(ve945[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063045 | Caenorhabditis elegans | T02C1.2(ve945[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. | Homozygous viable. Deletion of 1978 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAACTCTTTTGCTTACCAGAGTATTTTAT ; Right flanking sequence: TGGTAAAAAAACCATGAATTTATAATTTCC. T02C1.2 sgRNA A: TCATATTTTCCAATTCCAGG; T02C1.2 sgRNA B: GTTCCGTATTCGGTGTCTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063045 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:13 | 0 | ||||
|
Y49E10.27(ve946[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063046 | Caenorhabditis elegans | Y49E10.27(ve946[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. | Homozygous viable. Deletion of 1601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCAGTTCTGAGGGGTTTTTTCAATATCCG ; Right flanking sequence: aggcacagatttctcaattgatttcgcatg. Y49E10.27 sgRNA A: CATAAATGAACGAACACCGC; Y49E10.27 sgRNA B: ctacaaaaaatgcggagacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063046 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:13 | 0 | ||||
|
+/mT1 [umnIs52] II; mdh-2(ve947[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063047 | Caenorhabditis elegans | +/mT1 [umnIs52] II; mdh-2(ve947[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. | Made_by: RG KO Group|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 1490 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae, (ve947 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tctgttcatcatgtttcacgtggatgagag; Right flanking sequence: CGGCAACTCCTGGAGTATTGACGACGTCGT. mdh-2 sgRNA A: ggaagagacacagacagcgc; mdh-2 sgRNA B: ATCAATGTGCGAAAGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003162(mdh-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001072(dpy-10), WBGene00003162(mdh-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063047 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:13 | 0 | ||||
|
otub-1(ve948[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063048 | Caenorhabditis elegans | otub-1(ve948[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTTTCTTCTCTAAAAATTAAACATTTT ; Right flanking sequence: GATGTGCTCTCTCTTTCTCATCACCACTCC. otub-1 sgRNA A: CTTACAGGTAACAGGAACTA; otub-1 sgRNA B: GGGAGAGAAGACAAGAGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007718(otub-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007718(otub-1) | WB-STRAIN:WBStrain00063048 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:13 | 0 | ||||
|
dpy-10 (cn64) II; mlc-2(ftw80[LifeAct::wrmScarlet::SL2::mlc-2]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063096 | Caenorhabditis elegans | dpy-10 (cn64) II; mlc-2(ftw80[LifeAct::wrmScarlet::SL2::mlc-2]) X. | Dumpy roller. Endogenous mlc-2 locus co-expresses LifeAct peptide fused to wrmScarlet. Myosin light chain is untagged. Bright red fluorescence in all muscles is visible by dissection fluorescence microscopy. Broad bands of fluorescence are visible in body wall muscle by confocal microscopy. Please contact Ryan Littlefield prior to publishing work with this strain. | WBGene00001072(dpy-10)|WBGene00003370(mlc-2) | WBGene00001072(dpy-10), WBGene00003370(mlc-2) | WB-STRAIN:WBStrain00063096 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:14 | 0 | ||||
|
lem-2(sbw5[lem-2::mNeonGreen]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063130 | Caenorhabditis elegans | lem-2(sbw5[lem-2::mNeonGreen]) II. | Made_by: Sarah Barger|"mNeonGreen tag inserted at C-terminus of endogenous lem-2 locus using self-exising drug selection casette method (described by Hastie et al., 2019 J Microbiol Biol Educ). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https:" | WBGene00002275(lem-2) | WBGene00002275(lem-2) | WB-STRAIN:WBStrain00063130 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:14 | 0 | ||||
|
dpy-10(cn64) rab-3(ftw79) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063094 | Caenorhabditis elegans | dpy-10(cn64) rab-3(ftw79) II. | rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain. | WBGene00001072(dpy-10)|WBGene00004267(rab-3) | WBGene00001072(dpy-10), WBGene00004267(rab-3) | WB-STRAIN:WBStrain00063094 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:14 | 0 | ||||
|
mlc-2(ftw80[LifeAct::wrmScarlet::SL2::mlc-2]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063095 | Caenorhabditis elegans | mlc-2(ftw80[LifeAct::wrmScarlet::SL2::mlc-2]) X. | Endogenous mlc-2 locus co-expresses LifeAct peptide fused to wrmScarlet. Myosin light chain is untagged. Bright red fluorescence in all muscles is visible by dissection fluorescence microscopy. Broad bands of fluorescence are visible in body wall muscle by confocal microscopy. Please contact Ryan Littlefield prior to publishing work with this strain. | WBGene00003370(mlc-2) | WBGene00003370(mlc-2) | WB-STRAIN:WBStrain00063095 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:14 | 0 | ||||
|
lem-2(sbw20) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063133 | Caenorhabditis elegans | lem-2(sbw20) II. | CRISPR/Cas9-engineered deletion of entire lem-2 locus. Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https:|"Made_by: Sarah Barger" | WBGene00002275(lem-2) | WBGene00002275(lem-2) | WB-STRAIN:WBStrain00063133 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:14 | 0 | ||||
|
ustSi268 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063134 | Caenorhabditis elegans | ustSi268 I. | ustSi268 [mex-5p::tagrfp::elli-1::tbb-2 3'UTR] I. Inserted into LG I (-5.51 cM) locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544. | WB-STRAIN:WBStrain00063134 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:14 | 0 | ||||||
|
baf-1(sbw7[mNeonGreen::baf-1]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063131 | Caenorhabditis elegans | baf-1(sbw7[mNeonGreen::baf-1]) III. | Made_by: Sarah Barger|"mNeonGreen tag inserted at N-terminus of endogenous baf-1 locus using self-excising drug selection cassette method (described by Dickinson, et al. 2015, Genetics). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https:" | WBGene00000235(baf-1) | WBGene00000235(baf-1) | WB-STRAIN:WBStrain00063131 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:14 | 0 | ||||
|
tni-3(ftw13[tni-3::mCherry::SL2::GFP::NLS]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063099 | Caenorhabditis elegans | tni-3(ftw13[tni-3::mCherry::SL2::GFP::NLS]) V. | Endogenous tni-3 locus tagged with mCherry using CRISPR/Cas9. GFP-nls coexpressed from the endogenous promoter using SL2 trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.|"Made_by: Ryan Littlefield & Tammie Ward" | WBGene00006585(tni-3) | WBGene00006585(tni-3) | WB-STRAIN:WBStrain00063099 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:14 | 0 | ||||
|
fbf-2(ust337[fbf-2::GFP::3xFlag]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063138 | Caenorhabditis elegans | fbf-2(ust337[fbf-2::GFP::3xFlag]) II. | GFP::3xFlag inserted into endogenous fbf-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang" | WBGene00001402(fbf-2) | WBGene00001402(fbf-2) | WB-STRAIN:WBStrain00063138 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:14 | 0 | ||||
|
ZK1240.6(ve999[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063086 | Caenorhabditis elegans | ZK1240.6(ve999[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 398 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCCTGAAAATTAATATTAGGTACCTGACCT ; Right flanking sequence: ACTTGGAAATTGGAGAGCAAGTAAAAGTTA. ZK1240.6 sgRNA A: ACTTCAGAACCTGATATGCA; ZK1240.6 sgRNA B: TAGTCGAGTTATTCGTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063086 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:13 | 0 | ||||
|
Y25C1A.8(ve996[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063083 | Caenorhabditis elegans | Y25C1A.8(ve996[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 3675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CACTTTCTGGGCAAGAGCATTCACCGCCCG ; Right flanking sequence: CGGTTTCGCTGAAAATCGATAATTTTTGGG. Y25C1A.8 sgRNA A: CAGATGCTCATGCTCATGCT; Y25C1A.8 sgRNA B: CCAATTTTGCTTTTCGCGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063083 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:13 | 0 | ||||
|
tbb-4(tj74[gfp::TEV::3xFLAG::tbb-4]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063122 | Caenorhabditis elegans | tbb-4(tj74[gfp::TEV::3xFLAG::tbb-4]) X. | GFP::TEV::3xFLAG tag inserted into the endogenous tbb-4 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119. | WBGene00006538(tbb-4) | WBGene00006538(tbb-4) | WB-STRAIN:WBStrain00063122 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:14 | 0 | ||||
|
mec-7(tj77[gfp::TEV::3xFLAG::mec-7]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063123 | Caenorhabditis elegans | mec-7(tj77[gfp::TEV::3xFLAG::mec-7]) X. | GFP::TEV::3xFLAG tag inserted into the endogenous mec-7 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119. | WBGene00003171(mec-7) | WBGene00003171(mec-7) | WB-STRAIN:WBStrain00063123 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:14 | 0 | ||||
|
tba-7(tj66[gfp::TEV::3xFLAG::tba-7]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063120 | Caenorhabditis elegans | tba-7(tj66[gfp::TEV::3xFLAG::tba-7]) III. | GFP::TEV::3xFLAG tag inserted into the endogenous tba-7 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.|"Made_by: Hiroyuki Obinata" | WBGene00006533(tba-7) | WBGene00006533(tba-7) | WB-STRAIN:WBStrain00063120 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:14 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
