Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 7 showing 121 ~ 140 out of 122,835 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00055560

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: ZK1067.2(st12340[ZK1067.2::TY1::EGFP::3xFLAG]) II.
Notes: CRISPR/Cas9 engineered tagged endogenous locus.|"CRISPR/Cas9 engineered tagged endogneous locus."|"Made_by: EF/ATP"

Proper citation: RRID:WB-STRAIN:WBStrain00055560 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055562

Source Database: WormBase (WB)
Affected Genes: WBGene00013350(slr-2)
Genomic Alteration: WBGene00013350(slr-2)
Availability: unknown
Source References: EMPTY
Synonyms: slr-2(st12343[TY1::EGFP::3xFLAG::slr-2]) V.
Notes: CRISPR/Cas9 engineered tagged endogenous locus.|"Made_by: RW"

Proper citation: RRID:WB-STRAIN:WBStrain00055562 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055561

Source Database: WormBase (WB)
Affected Genes: WBGene00003854(odr-7)
Genomic Alteration: WBGene00003854(odr-7)
Availability: unknown
Source References: EMPTY
Synonyms: odr-7(st12342[TY::EGFP::3xFLAG::odr-7]) X.
Notes: CRISPR/Cas9 engineered tagged endogenous locus.|"Made_by: RW"

Proper citation: RRID:WB-STRAIN:WBStrain00055561 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055605

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010676(ctf-18)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010676(ctf-18)
Availability: unknown
Source References: EMPTY
Synonyms: ctf-18(hd7009[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00055605 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055607

Source Database: WormBase (WB)
Affected Genes: WBGene00002257(lbp-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002257(lbp-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: lbp-5(hd7016[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCTGATAATAAAACTTTCTTCAAATGCG; Right flanking sequence: GGCGGGCAACAAGGTTAAACGATGGCCAAT. sgRNA #1: AACTTTCTTCAAATGCGAGT; sgRNA #2: TTTAACGTGGAAGAGATGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00055607 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055601

Source Database: WormBase (WB)
Affected Genes: WBGene00001646(gna-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001646(gna-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: gna-1(hd7001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Deletion of 439 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTAACGTGTGAAATTTAGAAGCGCTGAG; Right flanking sequence: AGGAATGTGTGGAGCTAACACAGACGCATC. sgRNA #1: TCATAAAATTGCAATCGTCC; sgRNA #2: AAATTGTCAGGAAGATTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00055601 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055567

Source Database: WormBase (WB)
Affected Genes: WBGene00006604(tra-1)
Genomic Alteration: WBGene00006604(tra-1)
Availability: unknown
Source References: EMPTY
Synonyms: tra-1(st12348[TY1::EGFP::3xFLAG::tra-1]) III.
Notes: CRISPR/Cas9 engineered tagged endogenous locus.|"Made_by: RW"

Proper citation: RRID:WB-STRAIN:WBStrain00055567 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055603

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: W10C8.4(hd7005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 1936 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGTTTACAAAGTTTTAGCGGCCGACACCT; Right flanking sequence: AGGAATGATTCAAGATATATATATATATAG. sgRNA #1: TCTTATCTTAGAAACCCGCG; sgRNA #2: CTGTGTGTGAATACCAATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00055603 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055608

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F33D11.1(hd7023[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 515 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGAATCAAGCCCCAGTTGGCAGTCATTT; Right flanking sequence: TGGGATCTTCAACTTCGGATGATTGTTTGC. sgRNA #1: CATACAATGCCACACACGCG; sgRNA #2: GTGTTCATTCCGATTGTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00055608 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055553

Source Database: WormBase (WB)
Affected Genes: WBGene00004950(sox-3)
Genomic Alteration: WBGene00004950(sox-3)
Availability: unknown
Source References: EMPTY
Synonyms: sox-3(st12330[TY1::EGFP::3xFLAG::sox-3]) X.
Notes: CRISPR/Cas9 engineered tagged endogneous locus.|"Made_by: DKV/EF"

Proper citation: RRID:WB-STRAIN:WBStrain00055553 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055554

Source Database: WormBase (WB)
Affected Genes: WBGene00013111(sta-1)
Genomic Alteration: WBGene00013111(sta-1)
Availability: unknown
Source References: EMPTY
Synonyms: sta-1(st12332[sta-1::TY1::EGFP::3xFLAG]) IV.
Notes: CRISPR/Cas9 engineered tagged endogenous locus.|"CRISPR/Cas9 engineered tagged endogneous locus."|"Made_by: DKV/EF"

Proper citation: RRID:WB-STRAIN:WBStrain00055554 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055550

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: ZK337.2(st12326[ZK337.2::TY1::EGFP::3xFLAG]) I.
Notes: CRISPR/Cas9 engineered tagged endogenous locus.|"CRISPR/Cas9 engineered tagged endogneous locus."|"Made_by: DKV/EF"

Proper citation: RRID:WB-STRAIN:WBStrain00055550 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055557

Source Database: WormBase (WB)
Affected Genes: WBGene00001029(dnj-11)
Genomic Alteration: WBGene00001029(dnj-11)
Availability: unknown
Source References: EMPTY
Synonyms: dnj-11(st12337[TY1::EGFP::3xFLAG::dnj-11]) IV.
Notes: CRISPR/Cas9 engineered tagged endogenous locus.|"CRISPR/Cas9 engineered tagged endogneous locus."|"Made_by: EF/ATP"

Proper citation: RRID:WB-STRAIN:WBStrain00055557 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055558

Source Database: WormBase (WB)
Affected Genes: WBGene00000793(crh-1)
Genomic Alteration: WBGene00000793(crh-1)
Availability: unknown
Source References: EMPTY
Synonyms: crh-1(st12338[TY1::EGFP::3xFLAG::crh-1]) III.
Notes: CRISPR/Cas9 engineered tagged endogenous locus.|"CRISPR/Cas9 engineered tagged endogneous locus."|"Made_by: EF/ATP"

Proper citation: RRID:WB-STRAIN:WBStrain00055558 Copy   

    • RRID:WB-STRAIN:WBStrain00055542

http://www.wormbase.org/db/get?name=WBStrain00055542

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: tris113.
Notes: trIs113 [abu-14p::abu-14::GFP + rol-6(su1006)]. Rollers. Integrated line generated from an extrachromosomal array provided by David Raizen. References: George-Raizen JB, et al. Biol Open. 2014 Oct 31;3(11):1139-49. PMID: 25361578. Kamal M, et al. bioRxiv 2022.04.11.487937; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00055542 Copy   

    • RRID:WB-STRAIN:WBStrain00055544

http://www.wormbase.org/db/get?name=WBStrain00055544

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: trEx1001.
Notes: trEx1001 [idpb-3p::idpb-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00055544 Copy   

    • RRID:WB-STRAIN:WBStrain00055546

http://www.wormbase.org/db/get?name=WBStrain00055546

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: trEx1006.
Notes: trEx1006 [fipr-4p::fipr-4::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00055546 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055548

Source Database: WormBase (WB)
Affected Genes: WBGene00016739(pitr-1)
Genomic Alteration: WBGene00016739(pitr-1)
Availability: unknown
Source References: EMPTY
Synonyms: pitr-1(pw8[pitr-1::gfp]) IV.
Notes: GFP tag was inserted into the endogenous pitr-1 locus using CRISPR/Cas9 engineering. Reference: Balklava Z, et al. Genetics. 2016 Sep; 204(1): 153162. PMID: 27449055.

Proper citation: RRID:WB-STRAIN:WBStrain00055548 Copy   

    • RRID:WB-STRAIN:WBStrain00055547

http://www.wormbase.org/db/get?name=WBStrain00055547

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: trEx1008.
Notes: trEx1008 [idpa-3p::idpa-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00055547 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055596

Source Database: WormBase (WB)
Affected Genes: WBGene00000200(arx-2)|WBGene00016913(lam-2)
Genomic Alteration: WBGene00000200(arx-2), WBGene00016913(lam-2)
Availability: unknown
Source References: EMPTY
Synonyms: bmdSi339 I; bmdSi297 II; arx-2(wy1814[arx-2::mIAA7::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X.
Notes: bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. mNG tags inserted into endogenous arx-2 and lam-2 loci. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.

Proper citation: RRID:WB-STRAIN:WBStrain00055596 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch