Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
ZK1067.2(st12340[ZK1067.2::TY1::EGFP::3xFLAG]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055560 | Caenorhabditis elegans | ZK1067.2(st12340[ZK1067.2::TY1::EGFP::3xFLAG]) II. | CRISPR/Cas9 engineered tagged endogenous locus.|"CRISPR/Cas9 engineered tagged endogneous locus."|"Made_by: EF/ATP" | WB-STRAIN:WBStrain00055560 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:44 | 0 | ||||||
|
slr-2(st12343[TY1::EGFP::3xFLAG::slr-2]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055562 | Caenorhabditis elegans | slr-2(st12343[TY1::EGFP::3xFLAG::slr-2]) V. | CRISPR/Cas9 engineered tagged endogenous locus.|"Made_by: RW" | WBGene00013350(slr-2) | WBGene00013350(slr-2) | WB-STRAIN:WBStrain00055562 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 | ||||
|
odr-7(st12342[TY::EGFP::3xFLAG::odr-7]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055561 | Caenorhabditis elegans | odr-7(st12342[TY::EGFP::3xFLAG::odr-7]) X. | CRISPR/Cas9 engineered tagged endogenous locus.|"Made_by: RW" | WBGene00003854(odr-7) | WBGene00003854(odr-7) | WB-STRAIN:WBStrain00055561 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||
|
ctf-18(hd7009[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055605 | Caenorhabditis elegans | ctf-18(hd7009[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010676(ctf-18) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010676(ctf-18) | WB-STRAIN:WBStrain00055605 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 | ||||
|
lbp-5(hd7016[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055607 | Caenorhabditis elegans | lbp-5(hd7016[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCTGATAATAAAACTTTCTTCAAATGCG; Right flanking sequence: GGCGGGCAACAAGGTTAAACGATGGCCAAT. sgRNA #1: AACTTTCTTCAAATGCGAGT; sgRNA #2: TTTAACGTGGAAGAGATGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00002257(lbp-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00002257(lbp-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055607 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
gna-1(hd7001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055601 | Caenorhabditis elegans | gna-1(hd7001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Deletion of 439 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTAACGTGTGAAATTTAGAAGCGCTGAG; Right flanking sequence: AGGAATGTGTGGAGCTAACACAGACGCATC. sgRNA #1: TCATAAAATTGCAATCGTCC; sgRNA #2: AAATTGTCAGGAAGATTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00001646(gna-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001646(gna-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055601 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
tra-1(st12348[TY1::EGFP::3xFLAG::tra-1]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055567 | Caenorhabditis elegans | tra-1(st12348[TY1::EGFP::3xFLAG::tra-1]) III. | CRISPR/Cas9 engineered tagged endogenous locus.|"Made_by: RW" | WBGene00006604(tra-1) | WBGene00006604(tra-1) | WB-STRAIN:WBStrain00055567 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||
|
W10C8.4(hd7005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055603 | Caenorhabditis elegans | W10C8.4(hd7005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 1936 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGTTTACAAAGTTTTAGCGGCCGACACCT; Right flanking sequence: AGGAATGATTCAAGATATATATATATATAG. sgRNA #1: TCTTATCTTAGAAACCCGCG; sgRNA #2: CTGTGTGTGAATACCAATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055603 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
F33D11.1(hd7023[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055608 | Caenorhabditis elegans | F33D11.1(hd7023[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 515 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGAATCAAGCCCCAGTTGGCAGTCATTT; Right flanking sequence: TGGGATCTTCAACTTCGGATGATTGTTTGC. sgRNA #1: CATACAATGCCACACACGCG; sgRNA #2: GTGTTCATTCCGATTGTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055608 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 | ||||
|
sox-3(st12330[TY1::EGFP::3xFLAG::sox-3]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055553 | Caenorhabditis elegans | sox-3(st12330[TY1::EGFP::3xFLAG::sox-3]) X. | CRISPR/Cas9 engineered tagged endogneous locus.|"Made_by: DKV/EF" | WBGene00004950(sox-3) | WBGene00004950(sox-3) | WB-STRAIN:WBStrain00055553 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 | ||||
|
sta-1(st12332[sta-1::TY1::EGFP::3xFLAG]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055554 | Caenorhabditis elegans | sta-1(st12332[sta-1::TY1::EGFP::3xFLAG]) IV. | CRISPR/Cas9 engineered tagged endogenous locus.|"CRISPR/Cas9 engineered tagged endogneous locus."|"Made_by: DKV/EF" | WBGene00013111(sta-1) | WBGene00013111(sta-1) | WB-STRAIN:WBStrain00055554 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:44 | 0 | ||||
|
ZK337.2(st12326[ZK337.2::TY1::EGFP::3xFLAG]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055550 | Caenorhabditis elegans | ZK337.2(st12326[ZK337.2::TY1::EGFP::3xFLAG]) I. | CRISPR/Cas9 engineered tagged endogenous locus.|"CRISPR/Cas9 engineered tagged endogneous locus."|"Made_by: DKV/EF" | WB-STRAIN:WBStrain00055550 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 | ||||||
|
dnj-11(st12337[TY1::EGFP::3xFLAG::dnj-11]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055557 | Caenorhabditis elegans | dnj-11(st12337[TY1::EGFP::3xFLAG::dnj-11]) IV. | CRISPR/Cas9 engineered tagged endogenous locus.|"CRISPR/Cas9 engineered tagged endogneous locus."|"Made_by: EF/ATP" | WBGene00001029(dnj-11) | WBGene00001029(dnj-11) | WB-STRAIN:WBStrain00055557 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:44 | 0 | ||||
|
crh-1(st12338[TY1::EGFP::3xFLAG::crh-1]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055558 | Caenorhabditis elegans | crh-1(st12338[TY1::EGFP::3xFLAG::crh-1]) III. | CRISPR/Cas9 engineered tagged endogenous locus.|"CRISPR/Cas9 engineered tagged endogneous locus."|"Made_by: EF/ATP" | WBGene00000793(crh-1) | WBGene00000793(crh-1) | WB-STRAIN:WBStrain00055558 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||
|
tris113. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055542 | Caenorhabditis elegans | tris113. | trIs113 [abu-14p::abu-14::GFP + rol-6(su1006)]. Rollers. Integrated line generated from an extrachromosomal array provided by David Raizen. References: George-Raizen JB, et al. Biol Open. 2014 Oct 31;3(11):1139-49. PMID: 25361578. Kamal M, et al. bioRxiv 2022.04.11.487937; doi: https: | WB-STRAIN:WBStrain00055542 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:44 | 0 | ||||||
|
trEx1001. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055544 | Caenorhabditis elegans | trEx1001. | trEx1001 [idpb-3p::idpb-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https: | WB-STRAIN:WBStrain00055544 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:44 | 0 | ||||||
|
trEx1006. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055546 | Caenorhabditis elegans | trEx1006. | trEx1006 [fipr-4p::fipr-4::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https: | WB-STRAIN:WBStrain00055546 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||||
|
pitr-1(pw8[pitr-1::gfp]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055548 | Caenorhabditis elegans | pitr-1(pw8[pitr-1::gfp]) IV. | GFP tag was inserted into the endogenous pitr-1 locus using CRISPR/Cas9 engineering. Reference: Balklava Z, et al. Genetics. 2016 Sep; 204(1): 153162. PMID: 27449055. | WBGene00016739(pitr-1) | WBGene00016739(pitr-1) | WB-STRAIN:WBStrain00055548 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:44 | 0 | ||||
|
trEx1008. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055547 | Caenorhabditis elegans | trEx1008. | trEx1008 [idpa-3p::idpa-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https: | WB-STRAIN:WBStrain00055547 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 | ||||||
|
bmdSi339 I; bmdSi297 II; arx-2(wy1814[arx-2::mIAA7::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055596 | Caenorhabditis elegans | bmdSi339 I; bmdSi297 II; arx-2(wy1814[arx-2::mIAA7::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. | bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. mNG tags inserted into endogenous arx-2 and lam-2 loci. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258. | WBGene00000200(arx-2)|WBGene00016913(lam-2) | WBGene00000200(arx-2), WBGene00016913(lam-2) | WB-STRAIN:WBStrain00055596 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
