Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00036219

Source Database: WormBase (WB)
Affected Genes: WBGene00007615(set-31)
Genomic Alteration: WBGene00007615(set-31)
Availability: available
Source References: EMPTY
Synonyms: set-31(ok1482) V.
Alternate IDs: WB-STRAIN:VC978, CGC_VC978
Notes: C15H11.5. Superficially wild type.|"Made_by: Anna Rankin"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036219 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036213

Source Database: WormBase (WB)
Affected Genes: WBGene00000067(act-5)|WBGene00001072(dpy-10)
Genomic Alteration: WBGene00000067(act-5), WBGene00001072(dpy-10)
Availability: available
Source References: PMID:38190406
Synonyms: +/mT1 II; act-5(ok1397)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC971, CGC_VC971
Notes: Mutagen:UV/TMP|"T25C8.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1397 homozygotes (arrest stage/phenotype undetermined; may be sterile adult). Pick WT and check for correct segregation of progeny to maintain."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036213 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036222

Source Database: WormBase (WB)
Affected Genes: WBGene00001835(hda-2)
Genomic Alteration: WBGene00001835(hda-2)
Availability: available
Source References: EMPTY
Synonyms: hda-2(ok1479) II.
Alternate IDs: WB-STRAIN:VC983, CGC_VC983
Notes: C08B11.2. Superficially wild type.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036222 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036221

Source Database: WormBase (WB)
Affected Genes: WBGene00001499(fsn-1)
Genomic Alteration: WBGene00001499(fsn-1)
Availability: available
Source References: EMPTY
Synonyms: fsn-1(gk429) III.
Alternate IDs: WB-STRAIN:VC980, CGC_VC980
Notes: C26E6.5. Superficially wild type.|"Made_by: Vancouver KO Group"|"Mutagen:TMP+UV"|"Mutagen:TMP/UV"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036221 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036293

Source Database: WormBase (WB)
Affected Genes: WBGene00022516(mtx-2)
Genomic Alteration: WBGene00022516(mtx-2)
Availability: available
Source References: EMPTY
Synonyms: mtx-2(gk444) III.
Alternate IDs: WB-STRAIN:VC1064, CGC_VC1064
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZC97.1. Superficially wild type."

Proper citation: RRID:WB-STRAIN:WBStrain00036293 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036292

Source Database: WormBase (WB)
Affected Genes: WBGene00003753(nlp-15)
Genomic Alteration: WBGene00003753(nlp-15)
Availability: available
Source References: PMID:38573858
Synonyms: nlp-15(ok1512) I.
Alternate IDs: WB-STRAIN:VC1063, CGC_VC1063
Notes: CC4.2. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036292 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036359

Source Database: WormBase (WB)
Affected Genes: WBGene00006616(trp-4)
Genomic Alteration: WBGene00006616(trp-4)
Availability: available
Source References: PMID:31704915
Synonyms: trp-4(ok1605) I.
Alternate IDs: WB-STRAIN:VC1141, CGC_VC1141
Notes: Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y71A12B.4. Superficially wild type. External left primer: AAGACTCCGGTACACGTTGC. External right primer: AGAAGCATCCGCACAAGACT. Internal left primer: AAGTTTGGTGGCTCAATTCG. Internal right primer: CTTTGAGCGGCTAAATGGAG. Internal WT amplicon: 3332 bp. Deletion size: 1027 bp. Deletion left flank: GGCCGAGGTTACTGGACCAGGACCAGGGCC. Deletion right flank: TTTTACCGATTTTTAGGCAGAATTGATTTT."

Proper citation: RRID:WB-STRAIN:WBStrain00036359 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036319

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00008877(rtcb-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00008877(rtcb-1)
Availability: available
Source References: PMID:33157031
Synonyms: rtcb-1(gk451) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1094, CGC_VC1094
Notes: F16A11.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk451 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. May also segregate Bli non-GFP (hT2 homozygotes), which are the result of rare recombination. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCCTTCTTCATCAATTCC. External right primer: ATAATTTCTCGGACCCGCTT. Internal left primer: GCGTAATGATTTCCTGCTCC. Internal right primer: CATCATCTTTCCACCACACG. Internal WT amplicon: 1913 bp. Deletion size: 370 bp. Deletion left flank: ATGATTCACTAACCGAATGTCCAACAATTC. Deletion right flank: ATCTCAAAATCTTTAGTCAAGAAAACATTC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00036319 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036329

Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00003752(nlp-14)
Genomic Alteration: WBGene00003056(lon-2), WBGene00003752(nlp-14)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; nlp-14(ok1517)/szT1 X.
Alternate IDs: WB-STRAIN:VC1108, CGC_VC1108
Notes: D1009.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1517 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036329 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036328

Source Database: WormBase (WB)
Affected Genes: WBGene00022235(sqd-1)
Genomic Alteration: WBGene00022235(sqd-1)
Availability: available
Source References: EMPTY
Synonyms: sqd-1(ok1582) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1106, CGC_VC1106
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y73B6BL.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1582 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain."

Proper citation: RRID:WB-STRAIN:WBStrain00036328 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036323

Source Database: WormBase (WB)
Affected Genes: WBGene00002008(hsp-4)
Genomic Alteration: WBGene00002008(hsp-4)
Availability: available
Source References: PMID:34407398, PMID:36924492
Synonyms: hsp-4(gk514) II.
Alternate IDs: WB-STRAIN:VC1099, CGC_VC1099
Notes: F43E2.8. Superficially wild type.|"Mutagen:UV/TMP"|"Supplementary_genotype hsp-4(gk514) II"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061805 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00036323 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036497

Source Database: WormBase (WB)
Affected Genes: WBGene00004884(smg-6)
Genomic Alteration: WBGene00004884(smg-6)
Availability: available
Source References: EMPTY
Synonyms: smg-6(ok1794) III.
Alternate IDs: WB-STRAIN:VC1305, CGC_VC1305
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y54F10AL.2. Superficially wild type. External left primer: TAGCTAGCCCATGTGCCTTT. External right primer: TTTTGCGATGTGAATCGTGT. Internal left primer: TTTTAGCCACACCATCCACA. Internal right primer: CCAAAAACATGGGAAAATCG. Internal WT amplicon: 3113 bp. Deletion size: 920 bp. Deletion left flank: CAATTAAAAATTTTTTTTCTTGATTTTCTA. Deletion right flank: AAAATTGTGTCTAGGGGTGAAAAATTGCGA."

Proper citation: RRID:WB-STRAIN:WBStrain00036497 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036424

Source Database: WormBase (WB)
Affected Genes: WBGene00002101(ins-18)
Genomic Alteration: WBGene00002101(ins-18)
Availability: available
Source References: EMPTY
Synonyms: ins-18(ok1672) I.
Alternate IDs: WB-STRAIN:VC1218, CGC_VC1218
Notes: T28B8.2. Superficially wild type. External left primer: TTCAGATTGCTCGAAAGGCT. External right primer: GCCATTGTATCCATCCCATC. Internal left primer: CGTCGCCACTATTCCAAAAT. Internal right primer: CGTATTTTGTGGGCGGTACT. Internal WT amplicon: 2143 bp. Deletion size: 940 bp. Deletion left flank: AAGCTGGTTTGTTTTCATGTTTGTAATACA. Deletion right flank: TTTGGCAATTGGCAATTATTTAATTCTTTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036424 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036431

Source Database: WormBase (WB)
Affected Genes: WBGene00002222(klp-11)
Genomic Alteration: WBGene00002222(klp-11)
Availability: available
Source References: PMID:37463209, PMID:38302462
Synonyms: klp-11(tm324) IV.
Alternate IDs: WB-STRAIN:VC1228, CGC_VC1228
Notes: 331 bp deletion. T608 Stop. Flanking sequences: aaaatgagaaaaggaacaactgaattggac taatttttaaacacaaaacttactattgtt.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036431 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036435

Source Database: WormBase (WB)
Affected Genes: WBGene00003839(ocr-2)
Genomic Alteration: WBGene00003839(ocr-2)
Availability: available
Source References: PMID:36652499
Synonyms: ocr-2(ok1711) IV.
Alternate IDs: WB-STRAIN:VC1233, CGC_VC1233
Notes: T09A12.3. Superficially wild type. External left primer: TAGCATTTGTAAAACCCGGC. External right primer: AAAAACCCCCAATTTTCCTG. Internal left primer: CGAAAGCTTCAATGGGTGAT. Internal right primer: GGCTCCGAAAGCTTACCTCT. Internal WT amplicon: 2957 bp. Deletion size: 1512 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036435 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036448

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00021636(pcaf-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00021636(pcaf-1)
Availability: available
Source References: EMPTY
Synonyms: pcaf-1(ok1690) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1250, CGC_VC1250
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y47G6A.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1690 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGAAATCCCTTCGCACACT. External right primer: ATTGGCATTTTTCTAGCCGA. Internal left primer: GCGAAAAACAACGATTAGCC. Internal right primer: CTGGAACTTGGAAACTTGGG. Internal WT amplicon: 3142 bp. Deletion size: 1258 bp. Deletion left flank: CTACAGGAAGAGGAGAGTGGGCTCATTGAG. Deletion right flank: TTTGCCCATTTTTGCTAAAATTGAACCAAA. Insertion Sequence: CCCATTTTTGCCCATTTTTGCCCAT."

Proper citation: RRID:WB-STRAIN:WBStrain00036448 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036549

Source Database: WormBase (WB)
Affected Genes: WBGene00004466(rpn-10)
Genomic Alteration: WBGene00004466(rpn-10)
Availability: available
Source References: PMID:37355092
Synonyms: rpn-10(ok1865) I.
Alternate IDs: WB-STRAIN:VC1369, CGC_VC1369
Notes: B0205.3. Superficially wild type. External left primer: CTTTTTAAGCGGTGCGTCAT. External right primer: GCTCGATATTCCATCCGAAA. Internal left primer: TGGGTCTCTTCTCGCATCTC. Internal right primer: TGCACCAACAACTCCACATT. Internal WT amplicon: 2184 bp. Deletion size: 1166 bp. Deletion left flank: CAGAATCCGCGGCACCTCCATTTGCAGCAG. Deletion right flank: TATGAACTCTGTAGAATGTGAGAAATAAAA.|"Mutagen:UV/TMP"|"Supplementary_genotype (rpn-10(ok1865) I)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036549 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036595

Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00015391(sdha-1)
Genomic Alteration: WBGene00003056(lon-2), WBGene00015391(sdha-1)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; sdha-1(ok1908)/szT1 X.
Alternate IDs: WB-STRAIN:VC1434, CGC_VC1434
Notes: C03G5.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1908 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACGAAGGCAAACTGGTGAC. External right primer: CTACGAGCGGTTCATTTGGT. Internal left primer: AATAGGAGCGGACCTTTGGT. Internal right primer: GCAATTCCGCACGTTTATCT. Internal WT amplicon: 2954 bp. Deletion size: 1211 bp. Deletion left flank: GACGAAGCTCGGCAGTTGAGATGTCTCCCT. Deletion right flank: GCATTACAATTAAAATATTCTGATTAAGTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036595 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036524

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00006915(vha-6)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006915(vha-6)
Availability: available
Source References: EMPTY
Synonyms: vha-6(ok1825)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC1336, CGC_VC1336
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"VW02B12L.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1825 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAGAATGGCTCGAACT. External right primer: TCATCCATCATTCCAGAGCA. Internal left primer: GGAACTCGACCCAATGAAGA. Internal right primer: GGTGGCGGTCTGATATTGAT. Internal WT amplicon: 3301 bp. Deletion size: 982 bp. Deletion left flank: GGCTTGACGAGAAGCATAACTGGAACAGAT. Deletion right flank: GGAGCTGGATTAACTTCTCGATAGTTGGCA."

Proper citation: RRID:WB-STRAIN:WBStrain00036524 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036581

Source Database: WormBase (WB)
Affected Genes: WBGene00007799(nrx-1)
Genomic Alteration: WBGene00007799(nrx-1)
Availability: available
Source References: EMPTY
Synonyms: nrx-1(ok1649) V.
Alternate IDs: WB-STRAIN:VC1416, CGC_VC1416
Notes: C29A12.4. Mildly Unc. External left primer: CGGAAGCAAAGAAACCAAAG. External right primer: CTCTTGGCCAGATGTTCGAT. Internal left primer: TTATGCGGGAGATGAAAAGG. Internal right primer: GTTGAGCATTTGCAATCGAA. Internal WT amplicon: 3130 bp. Deletion size: 861 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036581 Copy   

•   Source: Integrated Animals