Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://www.mmrrc.org/catalog/cellLineSDS.php?mmrrc_id=60852
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: deletion
Affected Genes: |Prx|
Source References: PMID: 21677750
Alternate IDs: MMRRC_60852-UCD, MMRRC_060852, MMRRC_6852
Notes: Research areas: ; Mutation Type: deletion ; Collection: KOMP
Proper citation: RRID:MMRRC_060852-UCD Copy
https://www.mmrrc.org/catalog/cellLineSDS.php?mmrrc_id=61682
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: Targeted Mutation
Affected Genes: Rtf1
Source References: PMID: 21677750
Alternate IDs: MMRRC_61682-UCD, MMRRC_061682, MMRRC_61682
Notes: Research areas: ; Mutation Type: Targeted Mutation ; Collection: KOMP
Proper citation: RRID:MMRRC_061682-UCD Copy
https://www.mmrrc.org/catalog/cellLineSDS.php?mmrrc_id=61775
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: Targeted Mutation
Affected Genes: |Saraf|
Source References: PMID: 21677750
Alternate IDs: MMRRC_61775-UCD, MMRRC_061775, MMRRC_61775
Notes: Research areas: ; Mutation Type: Targeted Mutation ; Collection: KOMP
Proper citation: RRID:MMRRC_061775-UCD Copy
https://www.mmrrc.org/catalog/cellLineSDS.php?mmrrc_id=61837
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Affected Genes: |Scn7a|
Source References: PMID: 21677750
Alternate IDs: MMRRC_61837-UCD, MMRRC_061837, MMRRC_61837
Notes: Research areas: ; Mutation Type: ; Collection: KOMP
Proper citation: RRID:MMRRC_061837-UCD Copy
https://www.mmrrc.org/catalog/cellLineSDS.php?mmrrc_id=61774
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: deletion
Affected Genes: Sar1b
Source References: PMID: 12730667
Alternate IDs: MMRRC_61774-UCD, MMRRC_061774, MMRRC_61774
Notes: Research areas: ; Mutation Type: deletion ; Collection: KOMP
Proper citation: RRID:MMRRC_061774-UCD Copy
http://www.wormbase.org/db/get?name=WBStrain00006678
Source Database: WormBase (WB)
Affected Genes: WBGene00006763(unc-26)
Genomic Alteration: WBGene00006763(unc-26)
Availability: available
Source References: PMID:35065714, PMID:37053235
Synonyms: unc-26(s1710) IV.
Alternate IDs: WB-STRAIN:EG3027, CGC_EG3027
Notes: Severe kinker. Small and scrawny with flaccid little movement. Slow pharyngeal pumping.
Proper citation: RRID:WB-STRAIN:WBStrain00006678 Copy
http://www.wormbase.org/db/get?name=WBStrain00006618
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3011, CGC_ED3011
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J.|"Made_by: A. Cutter/E. Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006618 Copy
http://www.wormbase.org/db/get?name=WBStrain00006698
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33593818, PMID:33820969, PMID:38564369, PMID:39303031, PMID:39853894
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:EG4725, CGC_EG4725
Notes: Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00006698 Copy
http://www.wormbase.org/db/get?name=WBStrain00006622
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3017, CGC_ED3017
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): N.|"Made_by: A. Cutter/E. Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006622 Copy
http://www.wormbase.org/db/get?name=WBStrain00006640
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:37008729, PMID:37572357, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3052, CGC_ED3052
Notes: Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): delta.|"Made_by: E. Dolgin"|"Supplementary_genotype"
Proper citation: RRID:WB-STRAIN:WBStrain00006640 Copy
http://www.wormbase.org/db/get?name=WBStrain00006635
Source Database: WormBase (WB)
Availability: available
Source References: PMID:32857789, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3046, CGC_ED3046
Notes: Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): gamma.|"Made_by: E. Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006635 Copy
http://www.wormbase.org/db/get?name=WBStrain00006661
Source Database: WormBase (WB)
Affected Genes: WBGene00001373(exp-1)
Genomic Alteration: WBGene00001373(exp-1)
Availability: available
Source References: EMPTY
Synonyms: exp-1(ox276) II.
Alternate IDs: WB-STRAIN:EG276, CGC_EG276
Notes: Maintain under normal conditions. Reference: Beg AA & Jorgensen EM, Nat Neurosci. 2003 Nov;6(11):1145-52.
Proper citation: RRID:WB-STRAIN:WBStrain00006661 Copy
http://www.wormbase.org/db/get?name=WBStrain00006660
Source Database: WormBase (WB)
Affected Genes: WBGene00003553(nas-37)
Genomic Alteration: WBGene00003553(nas-37)
Availability: available
Source References: PMID:38177158
Synonyms: nas-37(ox199) X.
Alternate IDs: WB-STRAIN:EG199, CGC_EG199
Notes: At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.
Proper citation: RRID:WB-STRAIN:WBStrain00006660 Copy
http://www.wormbase.org/db/get?name=WBStrain00006659
Source Database: WormBase (WB)
Affected Genes: WBGene00002138(inx-16)
Genomic Alteration: WBGene00002138(inx-16)
Availability: available
Source References: EMPTY
Synonyms: inx-16(ox144) I.
Alternate IDs: WB-STRAIN:EG144, CGC_EG144
Notes: Pax, Dec-slow (34 defecation cycle). Maintain uder normal conditions. Reference: Peters MA, et al. Curr Biol. 2007 Sep 18;17(18):1601-8.
Proper citation: RRID:WB-STRAIN:WBStrain00006659 Copy
http://www.wormbase.org/db/get?name=WBStrain00006667
Source Database: WormBase (WB)
Affected Genes: WBGene00006783(unc-47)|WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00006783(unc-47), WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: PMID:31662251, PMID:34387338, PMID:37083456, PMID:37756590, PMID:37910615, PMID:39097626, PMID:39615303
Synonyms: lin-15B&lin-15A(n765) oxIs12 X.
Alternate IDs: WB-STRAIN:EG1285, CGC_EG1285
Notes: Mutagen:Integrated by X-rays|"oxIs12 [unc-47p::GFP + lin-15(+)]. Integration maps at +2.0 on X. Expression of GFP in all GABAergic neurons."|"Supplementary_genotype GABA-GFP oxIs12 [unc-47p::GFP + lin-15(+)]"|"Supplementary_genotype oxIs12 [unc-47p::GFP + lin-15(+)]"|"Supplementary_genotype oxIs12[punc-47::gfp] X"|"WBStrain provided so WBPaper00061788 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00006667 Copy
http://www.wormbase.org/db/get?name=WBStrain00006721
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:34665130
Synonyms: oxSi221 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:EG6070, CGC_EG6070
Notes: oxSi221 [eft-3p::GFP + Cbr-unc-119(+)] II. Broad, bright GFP fluorescence clearly visible on dissection scope. Single copy insert into MosSCI site ttTi5605 on Chr. II. Can be used as balancer.|"WBStrain provided so WBPaper00062054 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00006721 Copy
http://www.wormbase.org/db/get?name=WBStrain00006736
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:18953339, PMID:32550365, PMID:31995031, PMID:32275886, PMID:32587090, PMID:32687264, PMID:33543000, PMID:33976151, PMID:34003969, PMID:34397094, PMID:34542850, PMID:37857834, PMID:38329452, PMID:38456967, PMID:38498505, PMID:38547054, PMID:38797871, PMID:38744971, PMID:38924277, PMID:39105756
Synonyms: ttTi5605 II; unc-119(ed3) III; oxEx1578.
Alternate IDs: WB-STRAIN:EG6699, CGC_EG6699
Notes: Growth temperature 15 degC|"oxEx1578 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. [NOTE: New stock received at the CGC 03/21/12. Original stock was reported as no longer segregating Unc.]"|"Reference WBPaper00054440 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype ttTi5605 II unc-119 (ed3) III oxEx1578 (eft-3p::GFP + Cbr-unc-119(+))"|"WBStrain mapped, WBPaper00059536 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00059997 added based on AFP_Strain data."|"WBStrain provided so WBPaper00059884 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061624 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061786 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061940 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00006736 Copy
http://www.wormbase.org/db/get?name=WBStrain00006709
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: oxIs351 X.
Alternate IDs: WB-STRAIN:EG5025, CGC_EG5025
Notes: oxIs351 contains [unc-47p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type.
Proper citation: RRID:WB-STRAIN:WBStrain00006709 Copy
http://www.wormbase.org/db/get?name=WBStrain00006704
Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:EG4946, CGC_EG4946
Notes: C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.
Proper citation: RRID:WB-STRAIN:WBStrain00006704 Copy
http://www.wormbase.org/db/get?name=WBStrain00006957
Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001867(him-8), WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: oxTi302 I; oxTi75 II; oxTi411 unc-119(ed3) III; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:EG8040, CGC_EG8040
Notes: Made_by: Matthew LaBella|"oxTi302 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]; inserted in Chr. I: 10,166,145. oxTi75 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] II; inserted in Chr. II: 5,448,544. oxTi411 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)] inserted in Chr. III: 6,076,837. Him. Somewhat sick at higher temperatures. Maintain at 20C or below. This mapping strain uses three dominant fluorescent insertions that can be distinguished when scoring segregation. Please see www.wormbuilder.org for additional strain information."
Proper citation: RRID:WB-STRAIN:WBStrain00006957 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
