Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
PS7190
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031007 Caenorhabditis elegans syIs409 X. Made_by: Han Wang and Jonathan Liu|"syIs409"|"syIs409 [15xUAS::pes-10::mCherry::H2B::let-858 3'UTR + unc-122p::GFP + pBlueScript]. mCherry::H2B cGAL effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." WB-STRAIN:WBStrain00031007 WormBase (WB) WB available WB-STRAIN:PS7190, CGC_PS7190 2026-08-15 09:31:29 0
PS7185
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031005 Caenorhabditis elegans syIs406 IV. Made_by: Han Wang and Jonathan Liu|"syIs406 [15xUAS::pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. GFP::H2B effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." WB-STRAIN:WBStrain00031005 WormBase (WB) WB available WB-STRAIN:PS7185, CGC_PS7185 2026-08-15 09:31:29 0
PTM332
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031093 Caenorhabditis elegans nurf-1(kah106) II/ oxTi924 II N2 Background WB-STRAIN:WBStrain00031093 WormBase (WB) WB unknown WB-STRAIN:PTM332 2026-08-15 09:31:31 0
PTM325
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031092 Caenorhabditis elegans nurf-1(kah99)II/ oxTi924 II N2 Background WB-STRAIN:WBStrain00031092 WormBase (WB) WB unknown WB-STRAIN:PTM325 2026-08-15 09:31:31 0
PTM322
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031091 Caenorhabditis elegans nurf-1(kah96)II/ oxTi924 II N2 Background WB-STRAIN:WBStrain00031091 WormBase (WB) WB unknown WB-STRAIN:PTM322 2026-08-15 09:31:31 0
PS7731
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031014 Caenorhabditis elegans K03E5.2(sy1082) I. Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2.Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGGReference: Wang H, et al. G3 (Bethesda)." WBGene00019361(clik-3) WBGene00019361(clik-3) WB-STRAIN:WBStrain00031014 WormBase (WB) WB available PMID:30224336 WB-STRAIN:PS7731, CGC_PS7731 2026-08-15 09:31:29 0
PS7778
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031018 Caenorhabditis elegans clik-1(sy1084) V. Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagcReference: Wang H, et al. G3 (Bethesda)." WBGene00020808(clik-1) WBGene00020808(clik-1) WB-STRAIN:WBStrain00031018 WormBase (WB) WB available PMID:30224336 WB-STRAIN:PS7778, CGC_PS7778 2026-08-15 09:31:29 0
PS7735
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031017 Caenorhabditis elegans T05C3.2(sy1081) V STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc WB-STRAIN:WBStrain00031017 WormBase (WB) WB unknown PMID:30224336 WB-STRAIN:PS7735 2026-08-15 09:31:29 0
PS7734
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031016 Caenorhabditis elegans T05C3.2(sy1080) V. Made_by: Han Wang/Heenam Park/Wen Chen|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAARight flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" WBGene00020254(T05C3.2) WBGene00020254(T05C3.2) WB-STRAIN:WBStrain00031016 WormBase (WB) WB available PMID:30224336 WB-STRAIN:PS7734, CGC_PS7734 2026-08-15 09:31:29 0
PS7732
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031015 Caenorhabditis elegans K03E5.2 (sy1083) I STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc WB-STRAIN:WBStrain00031015 WormBase (WB) WB unknown PMID:30224336 WB-STRAIN:PS7732 2026-08-15 09:31:29 0
PT830
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031068 Caenorhabditis elegans nphp-1(ok500) II; nphp-4(tm925) him-5(e1490) V. Made_by: A. Jauregui|"Male mating response defect." WBGene00001864(him-5)|WBGene00010898(nphp-1)|WBGene00011261(nphp-4) WBGene00001864(him-5), WBGene00010898(nphp-1), WBGene00011261(nphp-4) WB-STRAIN:WBStrain00031068 WormBase (WB) WB available PMID:38302462 WB-STRAIN:PT830, CGC_PT830 2026-08-15 09:31:30 0
PT709
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00031067 Caenorhabditis elegans nphp-4(tm925) him-5(e1490) V. Made_by: A. Jauregui|"Superficially WT." WBGene00001864(him-5)|WBGene00011261(nphp-4) WBGene00001864(him-5), WBGene00011261(nphp-4) WB-STRAIN:WBStrain00031067 WormBase (WB) WB available WB-STRAIN:PT709, CGC_PT709 2026-08-15 09:31:30 1
PT559
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031066 Caenorhabditis elegans nphp-1(ok500) II; him-5(e1490) V. Made_by: A. Jauregui|"Superficially WT." WBGene00001864(him-5)|WBGene00010898(nphp-1) WBGene00001864(him-5), WBGene00010898(nphp-1) WB-STRAIN:WBStrain00031066 WormBase (WB) WB available WB-STRAIN:PT559, CGC_PT559 2026-08-15 09:31:30 0
PT505
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00031065 Caenorhabditis elegans flp-20(pk1596) X. EMPTY WBGene00001463(flp-20) WBGene00001463(flp-20) WB-STRAIN:WBStrain00031065 WormBase (WB) WB available PMID:39024405 WB-STRAIN:PT505, CGC_PT505 2026-08-15 09:31:30 2
PT501
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00031064 Caenorhabditis elegans flp-8(pk360) X. Reference: Liu T, et al. J Neurosci. 2007 Jul 4;27(27):7174-82. WBGene00001451(flp-8) WBGene00001451(flp-8) WB-STRAIN:WBStrain00031064 WormBase (WB) WB available PMID:39024405 WB-STRAIN:PT501, CGC_PT501 2026-08-15 09:31:30 2
PT442
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00031063 Caenorhabditis elegans klp-6(sy511) III; him-5(e1490) V. Males Lov and response defective. Mislocalizes pkd-2::GFP in cilia. sy511 contains a nonsense mutation in exon 10 (C-T transition = Q706stop). WBGene00001864(him-5)|WBGene00002218(klp-6) WBGene00001864(him-5), WBGene00002218(klp-6) WB-STRAIN:WBStrain00031063 WormBase (WB) WB available WB-STRAIN:PT442, CGC_PT442 2026-08-15 09:31:30 1
PT2193
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031071 Caenorhabditis elegans eat-4(n2474) III; him-5(e1490) V. Defective in male sex drive regulation. Reference: Nat Neurosci. 2012 Dec;15(12):1675-82. WBGene00001135(eat-4)|WBGene00001864(him-5) WBGene00001135(eat-4), WBGene00001864(him-5) WB-STRAIN:WBStrain00031071 WormBase (WB) WB available WB-STRAIN:PT2193, CGC_PT2193 2026-08-15 09:31:30 0
PT1443
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00031070 Caenorhabditis elegans inpp-5K(my15) III; him-5(e1490) V. Spermatogenesis abnormal with small brood size. PKD-2::GFP ciliary localization defective. Maintain at 20 C. inpp-5K formerly known as cil-1. Reference: Bae Y, et al. 2009 Curr Bio 19(19):1599-607. WBGene00001864(him-5)|WBGene00086546(inpp-5K) WBGene00001864(him-5), WBGene00086546(inpp-5K) WB-STRAIN:WBStrain00031070 WormBase (WB) WB available WB-STRAIN:PT1443, CGC_PT1443 2026-08-15 09:31:30 1
PTM117
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031078 Caenorhabditis elegans nurf-1(kah20)II N2 Background WB-STRAIN:WBStrain00031078 WormBase (WB) WB unknown WB-STRAIN:PTM117 2026-08-15 09:31:30 0
PTM113
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00031076 Caenorhabditis elegans nurf-1(kah16)II N2 Background WB-STRAIN:WBStrain00031076 WormBase (WB) WB unknown WB-STRAIN:PTM113 2026-08-15 09:31:30 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.