Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00031007
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: syIs409 X.
Alternate IDs: WB-STRAIN:PS7190, CGC_PS7190
Notes: Made_by: Han Wang and Jonathan Liu|"syIs409"|"syIs409 [15xUAS::pes-10::mCherry::H2B::let-858 3'UTR + unc-122p::GFP + pBlueScript]. mCherry::H2B cGAL effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."
Proper citation: RRID:WB-STRAIN:WBStrain00031007 Copy
http://www.wormbase.org/db/get?name=WBStrain00031005
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: syIs406 IV.
Alternate IDs: WB-STRAIN:PS7185, CGC_PS7185
Notes: Made_by: Han Wang and Jonathan Liu|"syIs406 [15xUAS::pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. GFP::H2B effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."
Proper citation: RRID:WB-STRAIN:WBStrain00031005 Copy
http://www.wormbase.org/db/get?name=WBStrain00031093
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: nurf-1(kah106) II/ oxTi924 II
Alternate IDs: WB-STRAIN:PTM332
Notes: N2 Background
Proper citation: RRID:WB-STRAIN:WBStrain00031093 Copy
http://www.wormbase.org/db/get?name=WBStrain00031092
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: nurf-1(kah99)II/ oxTi924 II
Alternate IDs: WB-STRAIN:PTM325
Notes: N2 Background
Proper citation: RRID:WB-STRAIN:WBStrain00031092 Copy
http://www.wormbase.org/db/get?name=WBStrain00031091
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: nurf-1(kah96)II/ oxTi924 II
Alternate IDs: WB-STRAIN:PTM322
Notes: N2 Background
Proper citation: RRID:WB-STRAIN:WBStrain00031091 Copy
http://www.wormbase.org/db/get?name=WBStrain00031014
Source Database: WormBase (WB)
Affected Genes: WBGene00019361(clik-3)
Genomic Alteration: WBGene00019361(clik-3)
Availability: available
Source References: PMID:30224336
Synonyms: K03E5.2(sy1082) I.
Alternate IDs: WB-STRAIN:PS7731, CGC_PS7731
Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2.Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGGReference: Wang H, et al. G3 (Bethesda)."
Proper citation: RRID:WB-STRAIN:WBStrain00031014 Copy
http://www.wormbase.org/db/get?name=WBStrain00031018
Source Database: WormBase (WB)
Affected Genes: WBGene00020808(clik-1)
Genomic Alteration: WBGene00020808(clik-1)
Availability: available
Source References: PMID:30224336
Synonyms: clik-1(sy1084) V.
Alternate IDs: WB-STRAIN:PS7778, CGC_PS7778
Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagcReference: Wang H, et al. G3 (Bethesda)."
Proper citation: RRID:WB-STRAIN:WBStrain00031018 Copy
http://www.wormbase.org/db/get?name=WBStrain00031017
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: T05C3.2(sy1081) V
Alternate IDs: WB-STRAIN:PS7735
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Proper citation: RRID:WB-STRAIN:WBStrain00031017 Copy
http://www.wormbase.org/db/get?name=WBStrain00031016
Source Database: WormBase (WB)
Affected Genes: WBGene00020254(T05C3.2)
Genomic Alteration: WBGene00020254(T05C3.2)
Availability: available
Source References: PMID:30224336
Synonyms: T05C3.2(sy1080) V.
Alternate IDs: WB-STRAIN:PS7734, CGC_PS7734
Notes: Made_by: Han Wang/Heenam Park/Wen Chen|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAARight flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00031016 Copy
http://www.wormbase.org/db/get?name=WBStrain00031015
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: K03E5.2 (sy1083) I
Alternate IDs: WB-STRAIN:PS7732
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Proper citation: RRID:WB-STRAIN:WBStrain00031015 Copy
http://www.wormbase.org/db/get?name=WBStrain00031068
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00010898(nphp-1)|WBGene00011261(nphp-4)
Genomic Alteration: WBGene00001864(him-5), WBGene00010898(nphp-1), WBGene00011261(nphp-4)
Availability: available
Source References: PMID:38302462
Synonyms: nphp-1(ok500) II; nphp-4(tm925) him-5(e1490) V.
Alternate IDs: WB-STRAIN:PT830, CGC_PT830
Notes: Made_by: A. Jauregui|"Male mating response defect."
Proper citation: RRID:WB-STRAIN:WBStrain00031068 Copy
http://www.wormbase.org/db/get?name=WBStrain00031067
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00011261(nphp-4)
Genomic Alteration: WBGene00001864(him-5), WBGene00011261(nphp-4)
Availability: available
Source References: EMPTY
Synonyms: nphp-4(tm925) him-5(e1490) V.
Alternate IDs: WB-STRAIN:PT709, CGC_PT709
Notes: Made_by: A. Jauregui|"Superficially WT."
Proper citation: RRID:WB-STRAIN:WBStrain00031067 Copy
http://www.wormbase.org/db/get?name=WBStrain00031066
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00010898(nphp-1)
Genomic Alteration: WBGene00001864(him-5), WBGene00010898(nphp-1)
Availability: available
Source References: EMPTY
Synonyms: nphp-1(ok500) II; him-5(e1490) V.
Alternate IDs: WB-STRAIN:PT559, CGC_PT559
Notes: Made_by: A. Jauregui|"Superficially WT."
Proper citation: RRID:WB-STRAIN:WBStrain00031066 Copy
http://www.wormbase.org/db/get?name=WBStrain00031065
Source Database: WormBase (WB)
Affected Genes: WBGene00001463(flp-20)
Genomic Alteration: WBGene00001463(flp-20)
Availability: available
Source References: PMID:39024405
Synonyms: flp-20(pk1596) X.
Alternate IDs: WB-STRAIN:PT505, CGC_PT505
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00031065 Copy
http://www.wormbase.org/db/get?name=WBStrain00031064
Source Database: WormBase (WB)
Affected Genes: WBGene00001451(flp-8)
Genomic Alteration: WBGene00001451(flp-8)
Availability: available
Source References: PMID:39024405
Synonyms: flp-8(pk360) X.
Alternate IDs: WB-STRAIN:PT501, CGC_PT501
Notes: Reference: Liu T, et al. J Neurosci. 2007 Jul 4;27(27):7174-82.
Proper citation: RRID:WB-STRAIN:WBStrain00031064 Copy
http://www.wormbase.org/db/get?name=WBStrain00031063
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00002218(klp-6)
Genomic Alteration: WBGene00001864(him-5), WBGene00002218(klp-6)
Availability: available
Source References: EMPTY
Synonyms: klp-6(sy511) III; him-5(e1490) V.
Alternate IDs: WB-STRAIN:PT442, CGC_PT442
Notes: Males Lov and response defective. Mislocalizes pkd-2::GFP in cilia. sy511 contains a nonsense mutation in exon 10 (C-T transition = Q706stop).
Proper citation: RRID:WB-STRAIN:WBStrain00031063 Copy
http://www.wormbase.org/db/get?name=WBStrain00031071
Source Database: WormBase (WB)
Affected Genes: WBGene00001135(eat-4)|WBGene00001864(him-5)
Genomic Alteration: WBGene00001135(eat-4), WBGene00001864(him-5)
Availability: available
Source References: EMPTY
Synonyms: eat-4(n2474) III; him-5(e1490) V.
Alternate IDs: WB-STRAIN:PT2193, CGC_PT2193
Notes: Defective in male sex drive regulation. Reference: Nat Neurosci. 2012 Dec;15(12):1675-82.
Proper citation: RRID:WB-STRAIN:WBStrain00031071 Copy
http://www.wormbase.org/db/get?name=WBStrain00031070
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00086546(inpp-5K)
Genomic Alteration: WBGene00001864(him-5), WBGene00086546(inpp-5K)
Availability: available
Source References: EMPTY
Synonyms: inpp-5K(my15) III; him-5(e1490) V.
Alternate IDs: WB-STRAIN:PT1443, CGC_PT1443
Notes: Spermatogenesis abnormal with small brood size. PKD-2::GFP ciliary localization defective. Maintain at 20 C. inpp-5K formerly known as cil-1. Reference: Bae Y, et al. 2009 Curr Bio 19(19):1599-607.
Proper citation: RRID:WB-STRAIN:WBStrain00031070 Copy
http://www.wormbase.org/db/get?name=WBStrain00031078
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: nurf-1(kah20)II
Alternate IDs: WB-STRAIN:PTM117
Notes: N2 Background
Proper citation: RRID:WB-STRAIN:WBStrain00031078 Copy
http://www.wormbase.org/db/get?name=WBStrain00031076
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: nurf-1(kah16)II
Alternate IDs: WB-STRAIN:PTM113
Notes: N2 Background
Proper citation: RRID:WB-STRAIN:WBStrain00031076 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.