Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=152995284
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 152995284
Notes: Substrain of Wistar, now bred at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk)
Proper citation: RRID:RGD_152995284 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631276
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 631276
Notes: Originated from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM)
Proper citation: RRID:RGD_631276 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=737861
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 737861
Notes: Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.
Proper citation: RRID:RGD_737861 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329849003
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 329849003
Notes: A complex of Cas9 protein and gRNA was introduced into Iar:LE fertilized rat eggs by electroporation. Combi-CRISPR (Yoshimi K. et al.) was used to induce knock-in. Knock-in rats were selected and crossed with wild-type rats to establish this strain. Sequence features: the intron just before the fourth exon of the Pvalb gene (intron 3) is deleted by NHEJ after double-strand break by one base compared to the wild-type. ---ttggcgggccagaacctcagggg---(wild-type) ---ttggcgggccagaacc-cagggg---(knock-in) National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329849003 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10053603
Source Database: Rat Genome Database (RGD)
Genetic Background: hybrid
Availability: Unknown
Alternate IDs: 10053603
Notes: This strain is a hybrid of WI-Foxn1em1Nips and WI-Foxn1em2Nips Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN
Proper citation: RRID:RGD_10053603 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329845600
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 329845600
Notes: Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em3 mutant carries a deletion of 56 base pairs containing the first methioine. Col4α5 em3 ratshave urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329845600 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631298
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 155631298
Notes: The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the catalytic domain in the rat Pde3a gene. The model has a carriesa CGT to TGD missense mutation and results in R862C substitutions in the protein
Proper citation: RRID:RGD_155631298 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401940197
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 401940197
Notes: The Ahr heterozygous rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats .
Proper citation: RRID:RGD_401940197 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405849408
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405849408
Notes: CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. This is a heterozygous strain which has decreased Xdh protein detected in the kidney cortex tissue as compared to the wild type littermate at 6-week old. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_405849408 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155630635
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 155630635
Notes: The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 7-bp deletion which results in frameshift and pre-mature stop truncated protein.
Proper citation: RRID:RGD_155630635 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=70458
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 70458
Notes: Heston in 1942 from Wistar stock of Nettleship, This WN is the parent to WN substrains maintained in other institutions.
Proper citation: RRID:RGD_70458 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401940195
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 401940195
Notes: The homozygous knockout rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats .
Proper citation: RRID:RGD_401940195 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688032
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Genomic Alteration: (null)
Availability: Unknown
Source References: (null)
Alternate IDs: 5688032
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688032 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10759544
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10759544
Notes: this strain was produced by CRISPR/Cas9 system. The resulting knock-in mutation is R411W in exon 11 of the GCDH gene.
Proper citation: RRID:RGD_10759544 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401960101
Source Database: Rat Genome Database (RGD)
Genetic Background: hybrid
Availability: Unknown
Alternate IDs: 401960101
Notes: This F1 obese model was developed by crossing rat strains with two separate leptin receptor mutations (fa and facp), In Charles River, they mate a Heterozygous ZDF (fa/+) with a Homozygous SHHF (cp/cp).This mating of ZDF and SHHF parent can produce obese ZSF1 (having fa and cp mutation from both parents) or lean ZSF1 (having just one copy of mutated Lepr, either cp or fa). The obese F1 develop insulin resistance, hyperglycaemia, and mild hypertension Charles River Laboratories
Proper citation: RRID:RGD_401960101 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329969882
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 329969882
Notes: The heart-specific cre expression plasmid (alpha-MHC-Cre) was produced by inserting the cre coding sequence downstream of the a-MHC (Mgh6) promoter in the a-MHC expression vector. The a-MHC-Cre transgenic rat was generated by microinjection of linearized alpha-MHC-Cre plasmid to Sprague Dawley embryos.
Proper citation: RRID:RGD_329969882 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329969883
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 329969883
Notes: A pair of synthetic oligonucleotides for sgRNA (sgRNA1, CCTTGCCGCTTTAAGTGACTC; sgRNA2, CCATGTTGGGAGCATTGCCTA) were annealed and then cloned into the pUC57-sgRNA expression vector, and the floxed plasmid donor was cloned into the pGSI plasmid. Both the Cas9 and sgRNA expression plasmids were linearized and used as templates for in vitro transcription. A mixture of the donor vector (4ââ¬â¦ng/ul), Cas9 mRNA (25ââ¬â¦ng/ul), and sgRNAs (10ââ¬â¦ng/ul each) was microinjected into both the cytoplasm and male pronucleus of the fertilized eggs. The injected zygotes were then transferred to pseudopregnant SD rats, which then carried them to parturition. This is called conditional knockout Trim44 (Trim44 cKO).
Proper citation: RRID:RGD_329969883 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405650195
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405650195
Notes: This is the wild type littermate from the crossing of heterozygous Esr1 mutant rats. This wild type littermate rat was used as a control for the homozygous mutant SD-Esr1em1-/- (RGD:405649860) in estrogen receptor study. Department of Medicine, Division of Pulmonary, Critical Care, Sleep and Occupational Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.
Proper citation: RRID:RGD_405650195 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401976374
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 401976374
Notes: This outbred Sprague Dawley was originally from Taconic and bred at SAMTAKO in Korea. Taconic
Proper citation: RRID:RGD_401976374 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=597538592
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 597538592
Notes: For the generation of transgenic rats, the authors used a 190-kb fused AF163864 PAC/AC097478 BAC clone (Yamakado et al., 2012, PMID:22475625). It contained the entire human SNCA sequence (GenBank AF163864), with 30-kb upstream regulatory promoter sequences and a 45-kb flanking downstream region, cloned into pBACe3.6 vector as described previously. Transgenic rats were obtained by injecting the purified BAC fragment into fertilized Sprague–Dawley oocytes at a concentration of 1.5 µg/ml. A founder line displaying the highest integration number of BAC DNA construct was crossedbred to homozygosity.
Proper citation: RRID:RGD_597538592 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
