Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00054665
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bqSi577 IV.
Notes: bqSi577 [myo-2p::GFP + unc-119(+)] IV. Expresses GFP in pharyngeal muscles. Single-copy insertion in the MosSCI locus cxTi10882 on chromosome IV. Obtained via the outcrossing of strain BN578 with N2. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.|"Made_by: Itai Toker"
Proper citation: RRID:WB-STRAIN:WBStrain00054665 Copy
http://www.wormbase.org/db/get?name=WBStrain00054709
Source Database: WormBase (WB)
Affected Genes: WBGene00004076(pod-2)
Genomic Alteration: WBGene00004076(pod-2)
Availability: unknown
Source References: EMPTY
Synonyms: pod-2(tn1765[gfp::3xflag::pod-2]) II.
Notes: Homozygous viable, gfp expression in intestine, hypodermis, somatic gonad, excretory duct, CAN neuron. Reference: Starich et al. eLife 2020;9:e58619. DOI: https:
Proper citation: RRID:WB-STRAIN:WBStrain00054709 Copy
http://www.wormbase.org/db/get?name=WBStrain00054740
Source Database: WormBase (WB)
Affected Genes: WBGene00002123(inx-1)
Genomic Alteration: WBGene00002123(inx-1)
Availability: unknown
Source References: EMPTY
Synonyms: inx-1(tm3524) X.
Notes: Derived by out-crossing parental strain FX18538 five times.|"Made_by: Savannah Sojka"
Proper citation: RRID:WB-STRAIN:WBStrain00054740 Copy
http://www.wormbase.org/db/get?name=WBStrain00054739
Source Database: WormBase (WB)
Affected Genes: WBGene00002123(inx-1)
Genomic Alteration: WBGene00002123(inx-1)
Availability: unknown
Source References: EMPTY
Synonyms: inx-1(tm6662) X.
Notes: Derived by out-crossing parental strain FX18537 five times.|"Made_by: Savannah Sojka"
Proper citation: RRID:WB-STRAIN:WBStrain00054739 Copy
http://www.wormbase.org/db/get?name=WBStrain00054850
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: ayIs9 II; lqIs220 X.
Notes: ayIs9 [egl-17p::GFP + dpy-20(+)]. Reference: Tamayo JV, et al. BMC Genomics. 2013 May 4;14:304. doi: 10.1186/1471-2164-14-304. PMID: 23642123.lqIs221 is a Pegl-17::mab-5::gfp transgene. ayIs9 is a Pegl-17::gfp transgene. AQR migration defects. AQR in the tail in the normal position of PQR.|"Made_by: Dr. Erik Lundquist"
Proper citation: RRID:WB-STRAIN:WBStrain00054850 Copy
http://www.wormbase.org/db/get?name=WBStrain00055017
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs825.
Notes: Made_by: Cyril Cros (Hobert Lab)|"otIs825 [degl-1p::GFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00055017 Copy
http://www.wormbase.org/db/get?name=WBStrain00055124
Source Database: WormBase (WB)
Affected Genes: WBGene00001135(eat-4)
Genomic Alteration: WBGene00001135(eat-4)
Availability: unknown
Source References: EMPTY
Synonyms: eat-4(syb4257[eat-4::T2A::GFP::H2B]) III.
Notes: Endogenous eat-4 locus tagged with T2A::GFP::H2B. Healthy strain that has all glutamatergic neurons marked with GFP. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425|"Made_by: Suny Biotech"
Proper citation: RRID:WB-STRAIN:WBStrain00055124 Copy
http://www.wormbase.org/db/get?name=WBStrain00055167
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: T07A9.10(syb6123[T07A9.10::SL2::GFP::H2B) IV.
Notes: GFP tag inserted at the C-terminus of the endogenous T07A9.10 locus by CRISPR. Punctate ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.|"Made_by: SUNY Biotech"
Proper citation: RRID:WB-STRAIN:WBStrain00055167 Copy
http://www.wormbase.org/db/get?name=WBStrain00055166
Source Database: WormBase (WB)
Affected Genes: WBGene00000239(bas-1)
Genomic Alteration: WBGene00000239(bas-1)
Availability: unknown
Source References: EMPTY
Synonyms: bas-1(syb5923[bas-1::SL2::GFP::H2B]) III.
Notes: GFP tag inserted into endogenous bas-1 locus by CRISPR/Cas9.|"Made_by: Oliver Hobert via SUNY Biotech"
Proper citation: RRID:WB-STRAIN:WBStrain00055166 Copy
http://www.wormbase.org/db/get?name=WBStrain00055173
Source Database: WormBase (WB)
Affected Genes: WBGene00020298(uncp-18)
Genomic Alteration: WBGene00020298(uncp-18)
Availability: unknown
Source References: EMPTY
Synonyms: uncp-18(syb6377) IV.
Notes: T07A9.10. syb6377 deletion removes all but exon 1 and part of exon 2 of uncp-18 locus. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
Proper citation: RRID:WB-STRAIN:WBStrain00055173 Copy
http://www.wormbase.org/db/get?name=WBStrain00055153
Source Database: WormBase (WB)
Affected Genes: WBGene00010278(degl-2)
Genomic Alteration: WBGene00010278(degl-2)
Availability: unknown
Source References: EMPTY
Synonyms: degl-2(syb5229[degl-2::SL2::gfp::H2B]) IV.
Notes: CRISPR/Cas9 engineered tagged endogenous locus.|"CRISPR/Cas9 engineered tagged endogneous locus."|"Made_by: Suny Biotech"
Proper citation: RRID:WB-STRAIN:WBStrain00055153 Copy
http://www.wormbase.org/db/get?name=WBStrain00055161
Source Database: WormBase (WB)
Affected Genes: WBGene00004013(pha-4)
Genomic Alteration: WBGene00004013(pha-4)
Availability: unknown
Source References: EMPTY
Synonyms: pha-4(ot946 ot1078 syb5755[pha-4::3xGAS::GFP::3xGAS::AID::TEV::LoxP::3xFLAG]) V.
Notes: Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.|"Made_by: SUNY Biotech"
Proper citation: RRID:WB-STRAIN:WBStrain00055161 Copy
http://www.wormbase.org/db/get?name=WBStrain00055403
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: fxIs47 II.
Notes: fxIs47 [rps-0p::5 (delta)HygR::GCGAAGTGACGGTAGACCGT::3 (delta)HygR::unc-54 3::LoxP, II:8420157]. Phenotypically wild-type strain carrying a landing pad for barcode integrations. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https:|"Made_by: Zachary Christopher Stevenson"
Proper citation: RRID:WB-STRAIN:WBStrain00055403 Copy
http://www.wormbase.org/db/get?name=WBStrain00055800
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37254647
Synonyms: npp-2(bq38[G>F>P::npp-2]) I; npp-24(bq22[G>P::npp-24]) bqSi189 [lmn-1p::mCherry::his-58::pie-1utr] II
Notes: cross between BN901 and BN1044 (npp-2(bq38[G>F>P::npp-2]))
Proper citation: RRID:WB-STRAIN:WBStrain00055800 Copy
http://www.wormbase.org/db/get?name=WBStrain00055750
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37773960, PMID:38116473, PMID:38946799
Synonyms: EMPTY
Notes: Supplementary_genotype rhdSi42[Pvit-3::mCherry::unc-54 3'UTR + cb-unc-119(+)] II|"[2023-11-01T19:46:10.012Z WBPerson712] New Strain: doi10.17912/micropub.biology.001047 WBPaper00066134 rhdSi42[Pvit-3::mCherry::unc-54 3'UTR; Cbr-unc-119(+)] II"
Proper citation: RRID:WB-STRAIN:WBStrain00055750 Copy
http://www.wormbase.org/db/get?name=WBStrain00055755
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37956057
Synonyms: EMPTY
Notes: [2023-11-15T23:23:09.753Z WBPerson712] New Strain: DOI10.1093/genetics/iyad197 WBPaper00066182 ZD2678 (cep-1(gk138); bcIs39)
Proper citation: RRID:WB-STRAIN:WBStrain00055755 Copy
http://www.wormbase.org/db/get?name=WBStrain00055754
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37956057
Synonyms: EMPTY
Notes: [2023-11-15T23:22:27.084Z WBPerson712] New Strain: DOI10.1093/genetics/iyad197 WBPaper00066182 ZD541 (pmk-1(km25); bcIs39)
Proper citation: RRID:WB-STRAIN:WBStrain00055754 Copy
http://www.wormbase.org/db/get?name=WBStrain00055756
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37956057
Synonyms: EMPTY
Notes: [2023-11-15T23:24:55.209Z WBPerson712] New Strain: DOI10.1093/genetics/iyad197 WBPaper00066182 ZD2691 (zip-2(ok3730); bcIs39)
Proper citation: RRID:WB-STRAIN:WBStrain00055756 Copy
http://www.wormbase.org/db/get?name=WBStrain00055898
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37254647
Synonyms: npp-12(ax4539[npp-12::mNeonGreen]) npp-11(ax4547[npp-11::wrmScarlet]) I
Notes: cross between JH3908 and JH4201
Proper citation: RRID:WB-STRAIN:WBStrain00055898 Copy
http://www.wormbase.org/db/get?name=WBStrain00055887
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37254647
Synonyms: npp-14(ax4543) I; bqSi189 [lmn-1p::mCherry::his-58::pie-1utr] II; xpo-1(ax4542[xpo-1::mNeonGreen]) V
Notes: cross between JH3955 and JH3886
Proper citation: RRID:WB-STRAIN:WBStrain00055887 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
