Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
FHH-Adipoqm2Mcwi Resource Report Resource Website |
RRID:RRRC_00407 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I164N mutation is generated in rat Adipoq. Rat Resource and Research Center | 00407 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryopreserved Sperm (as of 2017-01-13) | RGD_1579707, 1579707, RRRC_407, RRRC_0407, RRRC_00407 | 2026-09-12 04:18:54 | 0 | |||||
|
FHH-Nr0b2m1Mcwi Resource Report Resource Website |
RRID:RRRC_00403 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G96R mutation is generated from the codon change GGC/CGC. Rat Resource and Research Center | 00403 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryopreserved Sperm (as of 2017-01-26) | RGD_1579705, 1579705, RRRC_403, RRRC_0403, RRRC_00403 | 2026-09-12 04:18:54 | 0 | |||||
|
FHH-Tgfbr2m2Mcwi Resource Report Resource Website |
RRID:RRRC_00400 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E311K mutation is generated from the codon change GAG/AAG. Rat Resource and Research Center | 00400 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryopreserved Sperm (as of 2017-01-26) | RGD_1579685, 1579685, RRRC_400, RRRC_0400, RRRC_00400 | 2026-09-12 04:18:54 | 0 | |||||
|
F344-Lims1Tn(sb-T2/Bart3)2.169Mcwi Resource Report Resource Website |
RRID:RRRC_00362 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene. Rat Resource & Research Center | 00362 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryopreserved Sperm (as of 2017-01-26) | RGD_2290110, 2290110, RRRC_362, RRRC_0362, RRRC_00362 | 2026-09-12 04:18:55 | 0 | |||||
|
F344-Lrrc7Tn(sb-T2/Bart3)2.253Mcwi Resource Report Resource Website |
RRID:RRRC_00360 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7. Rat Resource and Research Center | 00360 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryopreserved Sperm (as of 2017-01-26) | RGD_2301079, 2301079, RRRC_360, RRRC_0360, RRRC_00360 | 2026-09-12 04:18:56 | 0 | |||||
|
SD-Krt71m1Yuyi Resource Report Resource Website |
RRID:RGD_10002787 | Rattus norvegicus | Several rats curled arose spontaneously in a closed colony of SD rats maintained at Laboratory Animal Center of Zhengzhou University. a 3 bp deletion at position 420-422 of Krt71 which results in the deletion of aspartate was identified. | 10002787 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10002787 | 2026-09-12 01:24:59 | 0 | |||||
|
SD-Fahem3Mcwi Resource Report Resource Website |
RRID:RGD_10002791 | Rattus norvegicus | This strain was produced by injecting TALENs targeting the sequence CTCAGTGTTCCTACTCTgcccctcccagaggttcaATGCTTTGTGTTCAATGTCG into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 3. Availability contact: [email protected] | 10002791 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-03) | 10002791 | 2026-09-12 01:24:59 | 0 | |||||
|
SS-Mmp9em4Mcwi Resource Report Resource Website |
RRID:RGD_10054414 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected] | 10054414 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 10054414 | 2026-09-12 01:25:00 | 0 | |||||
|
BN-Lx Resource Report Resource Website |
RRID:RGD_61113 | Rattus norvegicus | These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background. | 61113 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 61113 | 2026-09-12 01:25:00 | 0 | |||||
|
WI-Foxn1em1Nips Resource Report Resource Website 1+ mentions |
RRID:RGD_10053598 | Rattus norvegicus | Foxn1 mutation was induced by injecting pX330 expressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97). Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN | 10053598 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10053598 | 2026-09-12 01:24:59 | 1 | |||||
|
SD-Fusem1Ionsz Resource Report Resource Website |
RRID:RGD_10047085 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat. The mutation changed the 521th amino acid Arg (R) into Cys (C). Institute of Neuroscience, Chinese Academy of Sciences | 10047085 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10047085 | 2026-09-12 01:24:59 | 0 | |||||
|
LEW-Chrna5em1Mcwi Resource Report Resource Website |
RRID:RGD_10054386 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the Chrna5 gene. Contact MCW rat distribution at [email protected] | 10054386 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-11-26) | 10054386 | 2026-09-12 01:25:00 | 0 | |||||
|
LEW-Chrna4em3Mcwi Resource Report Resource Website |
RRID:RGD_10054383 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 16-bp deletion in the Chrna4 gene. Contact MCW rat distribution at [email protected] | 10054383 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-11-26) | 10054383 | 2026-09-12 01:25:00 | 0 | |||||
|
DA-Glaem2Mcwi Resource Report Resource Website |
RRID:RGD_10054398 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Gla gene of DA/OlaHsd rat embryos. The resulting mutation is a 47-bp deletion in the Gla gene. Contact MCW rat distribution at [email protected] | 10054398 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2018-10-22) | 10054398 | 2026-09-12 01:25:00 | 0 | |||||
|
FHH-Chr 3BN-Helz2em3Mcwi Resource Report Resource Website |
RRID:RGD_10054401 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3BN/Mcwi rat embryos.The resulting mutation is a 11-bp deletion in the Helz2 gene. Contact MCW rat distribution at [email protected] | 10054401 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2018-10-22) | 10054401 | 2026-09-12 01:25:00 | 0 | |||||
|
LEW-Chrna3em9Mcwi Resource Report Resource Website |
RRID:RGD_10054376 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos. The resulting mutation is a 17-bp deletion in the Chrna3 gene. Contact MCW rat distribution at [email protected] | 10054376 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-11-26) | 10054376 | 2026-09-12 01:25:00 | 0 | |||||
|
SS-Arhgef11em5Mcwi Resource Report Resource Website |
RRID:RGD_10054296 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in the Arhgef11 gene. Contact MCW rat distribution at [email protected] | 10054296 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054296 | 2026-09-12 01:25:01 | 0 | |||||
|
SS-Sirt3em4Mcwi Resource Report Resource Website |
RRID:RGD_10054453 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Sirt3 gene. Contact MCW rat distribution at [email protected] | 10054453 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 10054453 | 2026-09-12 01:25:01 | 0 | |||||
|
T2DN-Sirt3em35Mcwi Resource Report Resource Website |
RRID:RGD_10054456 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of T2DN/Mcwi rat embryos. The resulting mutation is a 82-bp deletion of exon 3 in the Sirt3 gene. Contact MCW rat distribution at [email protected] | 10054456 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054456 | 2026-09-12 01:25:01 | 0 | |||||
|
SS-Sirt3em25Mcwi Resource Report Resource Website |
RRID:RGD_10054450 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in the Sirt3 gene. Contact MCW rat distribution at [email protected] | 10054450 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054450 | 2026-09-12 01:25:01 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
