SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 6 showing 101 ~ 120 out of 1,458 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2290110

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2290110, 2290110, RRRC_362, RRRC_0362, RRRC_00362
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene. Rat Resource & Research Center

Proper citation: RRID:RRRC_00362 Copy   


http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2301079

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2301079, 2301079, RRRC_360, RRRC_0360, RRRC_00360
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7. Rat Resource and Research Center

Proper citation: RRID:RRRC_00360 Copy   


  • RRID:RGD_10002787

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10002787

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10002787
Notes: Several rats curled arose spontaneously in a closed colony of SD rats maintained at Laboratory Animal Center of Zhengzhou University. a 3 bp deletion at position 420-422 of Krt71 which results in the deletion of aspartate was identified.

Proper citation: RRID:RGD_10002787 Copy   


  • RRID:RGD_10002791

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10002791

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 10002791
Notes: This strain was produced by injecting TALENs targeting the sequence CTCAGTGTTCCTACTCTgcccctcccagaggttcaATGCTTTGTGTTCAATGTCG into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 3. Availability contact: [email protected]

Proper citation: RRID:RGD_10002791 Copy   


  • RRID:RGD_10054414

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054414

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 10054414
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054414 Copy   


  • RRID:RGD_61113

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61113

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 61113
Notes: These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background.

Proper citation: RRID:RGD_61113 Copy   


  • RRID:RGD_10053598

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10053598

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10053598
Notes: Foxn1 mutation was induced by injecting pX330 expressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97). Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN

Proper citation: RRID:RGD_10053598 Copy   


  • RRID:RGD_10047085

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10047085

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10047085
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat. The mutation changed the 521th amino acid Arg (R) into Cys (C). Institute of Neuroscience, Chinese Academy of Sciences

Proper citation: RRID:RGD_10047085 Copy   


  • RRID:RGD_10054386

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054386

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-11-26)
Alternate IDs: 10054386
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the Chrna5 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054386 Copy   


  • RRID:RGD_10054383

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054383

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-11-26)
Alternate IDs: 10054383
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 16-bp deletion in the Chrna4 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054383 Copy   


  • RRID:RGD_10054398

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054398

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054398
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Gla gene of DA/OlaHsd rat embryos. The resulting mutation is a 47-bp deletion in the Gla gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054398 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054401

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054401
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3BN/Mcwi rat embryos.The resulting mutation is a 11-bp deletion in the Helz2 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054401 Copy   


  • RRID:RGD_10054376

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054376

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-11-26)
Alternate IDs: 10054376
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos. The resulting mutation is a 17-bp deletion in the Chrna3 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054376 Copy   


  • RRID:RGD_10054296

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054296

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054296
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in the Arhgef11 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054296 Copy   


  • RRID:RGD_10054453

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054453

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 10054453
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Sirt3 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054453 Copy   


  • RRID:RGD_10054456

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054456

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054456
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of T2DN/Mcwi rat embryos. The resulting mutation is a 82-bp deletion of exon 3 in the Sirt3 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054456 Copy   


  • RRID:RGD_10054450

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054450

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054450
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in the Sirt3 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054450 Copy   


  • RRID:RGD_10002794

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10002794

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 10002794
Notes: This strain was produced by injecting TALENs targeting the sequence CTTAGACAACTCTCAATAGCTttatgggcctcggccAAGCGGCATGGAAGGAGGC into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_10002794 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2299122

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2017-01-26)
Alternate IDs: 2299122
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene.

Proper citation: RRID:RGD_2299122 Copy   


  • RRID:RGD_625624

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625624

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 625624
Notes: Eker rat is derived from the Long-Evans strain that has a mutation in Tsc2 gene. Originally reported by R. Eker in 1954 at the Norwegian Radium Hospital, Oslo.

Proper citation: RRID:RGD_625624 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X