Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00027302
Source Database: WormBase (WB)
Affected Genes: WBGene00002285(let-7)
Genomic Alteration: WBGene00002285(let-7)
Availability: available
Source References: PMID:10706289, PMID:31735670
Synonyms: let-7(n2853) X.
Alternate IDs: WB-STRAIN:MT7626, CGC_MT7626
Notes: Temperature sensitive - maintain at 15C. Seam cells divide in L4-to-adult molt. Animals undergo extra molt and explode at vulva. Males have leptoderan-like tail. Animals explode or are sterile at 25C.|"WBStrain provided so WBPaper00061289 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00027302 Copy
http://www.wormbase.org/db/get?name=WBStrain00027342
Source Database: WormBase (WB)
Affected Genes: WBGene00000419(ced-5)|WBGene00003828(nuc-1)
Genomic Alteration: WBGene00000419(ced-5), WBGene00003828(nuc-1)
Availability: available
Source References: EMPTY
Synonyms: ced-5(n1812) IV; nuc-1(e1392) X.
Alternate IDs: WB-STRAIN:MT8793, CGC_MT8793
Notes: n1812: dead cells persist, maternal rescue of embryonic.
Proper citation: RRID:WB-STRAIN:WBStrain00027342 Copy
http://www.wormbase.org/db/get?name=WBStrain00027337
Source Database: WormBase (WB)
Affected Genes: WBGene00002239(ksr-1)
Genomic Alteration: WBGene00002239(ksr-1)
Availability: available
Source References: PMID:8521514
Synonyms: ksr-1(n2526) X.
Alternate IDs: WB-STRAIN:MT8677, CGC_MT8677
Notes: Suppressor of n1046. Strong allele.
Proper citation: RRID:WB-STRAIN:WBStrain00027337 Copy
http://www.wormbase.org/db/get?name=WBStrain00027329
Source Database: WormBase (WB)
Affected Genes: WBGene00001179(egl-10)
Genomic Alteration: WBGene00001179(egl-10)
Availability: available
Source References: PMID:8548815, PMID:34037773, PMID:34506477, PMID:37155851, PMID:38362034
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:MT8504, CGC_MT8504
Notes: Animals are Egl and show sluggish locomotion and foraging behavior. Null allele: egl-10 is deleted or severely rearranged, and EGL-10 protein is undetected by Western blotting and in situ staining of animals.|"Properties Mutagen Spontaneous in TR403"|"WBStrain mapped, WBPaper00061459 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00027329 Copy
http://www.wormbase.org/db/get?name=WBStrain00027350
Source Database: WormBase (WB)
Affected Genes: WBGene00003006(lin-17)
Genomic Alteration: WBGene00003006(lin-17)
Availability: available
Source References: PMID:8804313
Synonyms: lin-17(n3091) I.
Alternate IDs: WB-STRAIN:MT8904, CGC_MT8904
Notes: Mail tale abnormal. Bivulva.
Proper citation: RRID:WB-STRAIN:WBStrain00027350 Copy
http://www.wormbase.org/db/get?name=WBStrain00027348
Source Database: WormBase (WB)
Affected Genes: WBGene00001061(dpl-1)
Genomic Alteration: WBGene00001061(dpl-1)
Availability: available
Source References: EMPTY
Synonyms: dpl-1(n2994) II.
Alternate IDs: WB-STRAIN:MT8879, CGC_MT8879
Notes: Synthetic Muv B.
Proper citation: RRID:WB-STRAIN:WBStrain00027348 Copy
http://www.wormbase.org/db/get?name=WBStrain00027344
Source Database: WormBase (WB)
Affected Genes: WBGene00003035(lin-52)
Genomic Alteration: WBGene00003035(lin-52)
Availability: available
Source References: PMID:31397537
Synonyms: lin-52(n771) III.
Alternate IDs: WB-STRAIN:MT8839, CGC_MT8839
Notes: Made_by: Ferguson/Jeff Thomas|"synMuv class B."
Proper citation: RRID:WB-STRAIN:WBStrain00027344 Copy
http://www.wormbase.org/db/get?name=WBStrain00027346
Source Database: WormBase (WB)
Affected Genes: WBGene00003037(lin-54)
Genomic Alteration: WBGene00003037(lin-54)
Availability: available
Source References: EMPTY
Synonyms: lin-54(n2231) IV.
Alternate IDs: WB-STRAIN:MT8841, CGC_MT8841
Notes: synMuv class B.
Proper citation: RRID:WB-STRAIN:WBStrain00027346 Copy
http://www.wormbase.org/db/get?name=WBStrain00027487
Source Database: WormBase (WB)
Affected Genes: WBGene00003324(mir-231)
Genomic Alteration: WBGene00003324(mir-231)
Availability: available
Source References: EMPTY
Synonyms: mir-231(n4571) III.
Alternate IDs: WB-STRAIN:MT14768, CGC_MT14768
Notes: Deletion breakpoints are: CATAAATTTCAGGAAAGC / ATGTGGTAAAATATGAAT...ATGTGAATGAAAATAAACC / GCCAAAAATATCAAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027487 Copy
http://www.wormbase.org/db/get?name=WBStrain00027429
Source Database: WormBase (WB)
Affected Genes: WBGene00019883(met-2)
Genomic Alteration: WBGene00019883(met-2)
Availability: available
Source References: PMID:31815663, PMID:32451438, PMID:34648748
Synonyms: met-2(n4256) III
Alternate IDs: WB-STRAIN:MT13293, CGC_MT13293
Notes: Deletion of R05D3.11.|"Reference WBPaper00059681 added based on published strain data identified by Textpresso literature search."
Proper citation: RRID:WB-STRAIN:WBStrain00027429 Copy
http://www.wormbase.org/db/get?name=WBStrain00027427
Source Database: WormBase (WB)
Affected Genes: WBGene00022149(lin-65)
Genomic Alteration: WBGene00022149(lin-65)
Availability: available
Source References: EMPTY
Synonyms: lin-65(n3441) I.
Alternate IDs: WB-STRAIN:MT13232, CGC_MT13232
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00027427 Copy
http://www.wormbase.org/db/get?name=WBStrain00027462
Source Database: WormBase (WB)
Affected Genes: WBGene00003304(mir-76)
Genomic Alteration: WBGene00003304(mir-76)
Availability: available
Source References: EMPTY
Synonyms: mir-76(n4474) III.
Alternate IDs: WB-STRAIN:MT14451, CGC_MT14451
Notes: Deletion breakpoints are:ATGTCTTAATTTCTAGT / GGAGCTATTGATTTTCGAAA...TGGCCTCGATTTTCTTCT / CGCAATATGGATCGTTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:ATGTCTTAATTTCTAGT / GGAGCTATTGATTTTCGAAA...TGGCCTCGATTTTCTTCT / CGCAATATGGATCGTTGC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027462 Copy
http://www.wormbase.org/db/get?name=WBStrain00027458
Source Database: WormBase (WB)
Affected Genes: WBGene00003321(mir-228)
Genomic Alteration: WBGene00003321(mir-228)
Availability: available
Source References: EMPTY
Synonyms: mir-228(n4382) IV.
Alternate IDs: WB-STRAIN:MT14446, CGC_MT14446
Notes: Deletion breakpoints are: GTACACAGAACAATAGAAATCGCCT / CGTTTCTGTTT...CTACGATATTAT / GTCCGAATTAAATTGCTTTTTTTTTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027458 Copy
http://www.wormbase.org/db/get?name=WBStrain00027454
Source Database: WormBase (WB)
Affected Genes: WBGene00001502(ftt-2)
Genomic Alteration: WBGene00001502(ftt-2)
Availability: available
Source References: EMPTY
Synonyms: ftt-2(n4426) X.
Alternate IDs: WB-STRAIN:MT14355, CGC_MT14355
Notes: Mutagen:UV/TMP|"Superficially WT. Low brood size. Usually bag at day 2-3 of adulthood. 650nt deletion takes out a promoter and an ATG; predicted to be a molecular null."
Proper citation: RRID:WB-STRAIN:WBStrain00027454 Copy
http://www.wormbase.org/db/get?name=WBStrain00027480
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00009671(mfap-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00009671(mfap-1)
Availability: available
Source References: EMPTY
Synonyms: mfap-1(n4564 n5214) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:MT14728, CGC_MT14728
Notes: Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP mfap-1 homozygotes. Pick WT GFP and check for correct segregation of progeny to maintain. mfap-1(n4564 n5214) mutants exhibit temperature-sensitive lethality: at 15C, (n4564 n5214) homozygous animals grow and behave similarly to wild-type; at 20C mutant animals grow more slowly, have few progeny and are hyperactive; at 25C the mutant strain is embryonically lethal. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Ma L, et al. PLoS Genet. 2012;8(7):e1002827.|"Segregates WT green-glowing heterozygotes and non-glowing mfap-1 homozygotes. mfap-1(n4564 n5214) mutants exhibit temperature-sensitive lethality: at 15C, (n4564 n5214) homozygous animals grow and behave similarly to wild-type; at 20C mutant animals grow more slowly, have few progeny and are hyperactive; at 25C the mutant strain is embryonically lethal. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Ma L, et al. PLoS Genet. 2012;8(7):e1002827."
Proper citation: RRID:WB-STRAIN:WBStrain00027480 Copy
http://www.wormbase.org/db/get?name=WBStrain00027473
Source Database: WormBase (WB)
Affected Genes: WBGene00001175(egl-6)
Genomic Alteration: WBGene00001175(egl-6)
Availability: available
Source References: PMID:37769660
Synonyms: egl-6(n4537) X.
Alternate IDs: WB-STRAIN:MT14666, CGC_MT14666
Notes: 2201 bp deletion in C46F4.1. Reference: Ringstad N, Horvitz HR. Nat Neurosci. 2008 Oct;11(10):1168-76.|"Supplementary_genotype egl-6(n4537lf)"
Proper citation: RRID:WB-STRAIN:WBStrain00027473 Copy
http://www.wormbase.org/db/get?name=WBStrain00027500
Source Database: WormBase (WB)
Affected Genes: WBGene00006600(tph-1)
Genomic Alteration: WBGene00006600(tph-1)
Availability: available
Source References: PMID:33007049, PMID:36653384, PMID:37155851, PMID:38302462, PMID:38555276
Synonyms: tph-1(n4622) II.
Alternate IDs: WB-STRAIN:MT14984, CGC_MT14984
Notes: Egl. Reduced pharyngeal pumping.|"Made_by: Dan Omura"|"WBStrain provided so WBPaper00060405 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00027500 Copy
http://www.wormbase.org/db/get?name=WBStrain00027531
Source Database: WormBase (WB)
Affected Genes: WBGene00002169(isw-1)
Genomic Alteration: WBGene00002169(isw-1)
Availability: available
Source References: PMID:31397537, PMID:38190406
Synonyms: isw-1(n3294) III.
Alternate IDs: WB-STRAIN:MT15795, CGC_MT15795
Notes: Wild type vulva; semi-sterile. Suppressor of lin-53(n833) and lin-15(n767).
Proper citation: RRID:WB-STRAIN:WBStrain00027531 Copy
http://www.wormbase.org/db/get?name=WBStrain00027532
Source Database: WormBase (WB)
Affected Genes: WBGene00003334(mir-240)
Genomic Alteration: WBGene00003334(mir-240)
Availability: available
Source References: EMPTY
Synonyms: mir-240(n4541) X.
Alternate IDs: WB-STRAIN:MT15873, CGC_MT15873
Notes: Deletion breakpoints are:TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027532 Copy
http://www.wormbase.org/db/get?name=WBStrain00027557
Source Database: WormBase (WB)
Affected Genes: WBGene00003288(mir-60)
Genomic Alteration: WBGene00003288(mir-60)
Availability: available
Source References: EMPTY
Synonyms: mir-60(n4947) II.
Alternate IDs: WB-STRAIN:MT16471, CGC_MT16471
Notes: Deletion breakpoints are:GAAACTTGTTCTGATACAGTA / ATTTTCAAAGAACCATCCATG...GGGCTTATGGAATGGTAG / ATAGTTGAGACACAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GAAACTTGTTCTGATACAGTA / ATTTTCAAAGAACCATCCATG...GGGCTTATGGAATGGTAG / ATAGTTGAGACACAGAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027557 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
