Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
ST65 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034489 | Caenorhabditis elegans | ncIs13. | ncIs13 [ajm-1::GFP]. | WBGene00000100(ajm-1) | WBGene00000100(ajm-1) | WB-STRAIN:WBStrain00034489 | WormBase (WB) | WB | available | PMID:39212544 | WB-STRAIN:ST65, CGC_ST65 | 2026-08-15 09:32:39 | 1 | ||
|
SS712 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034451 | Caenorhabditis elegans | ife-1(bn127) III. | Made_by: Dunkelbarger/Strome|"Mutagen:UV/TMP"|"Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt" | WBGene00002059(ife-1) | WBGene00002059(ife-1) | WB-STRAIN:WBStrain00034451 | WormBase (WB) | WB | available | WB-STRAIN:SS712, CGC_SS712 | 2026-08-15 09:32:38 | 2 | |||
|
SSM264 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034464 | Caenorhabditis elegans | rad-51(iow53[GFP::rad-51]) IV/nT1[qIs51] (IV;V). | Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes. Balancer is prone to breaking down. If a population contains a mix of bright and dim GFP animals, pick dim GFP and check for correct segregation of progeny to maintain. iow53 inserted a GFP tag at the N-terminus of the endogenous rad-51 locus, but the tagged protein is not fully functional. non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes form GFP foci in the germline that are mostly spo-11 dependent, and GFP::rad-51 homozygotes have defects in unloading RAD-51. Created by CRISPR using pDD282, therefore may also contain 3XFLAG. Reference: Koury E, et al. Nucleic Acids Res. 2018 Jan 25;46(2):748-764.|"Made_by: Matthew Wheat and Emily Koury" | WBGene00004297(rad-51) | WBGene00004297(rad-51) | WB-STRAIN:WBStrain00034464 | WormBase (WB) | WB | available | WB-STRAIN:SSM264, CGC_SSM264 | 2026-08-15 09:32:38 | 1 | |||
|
SS186 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034436 | Caenorhabditis elegans | mes-2(bn11) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | Heterozygotes are WT and segregate WT, DpyUnc and Uncs which give sterile progeny (maternal effect sterile: the progeny from mutant mothers are sterile). The mutation is a strict mel, fully penetrant, and fully expressed. Sterility is due to a failure in germ-cell proliferation.|"Supplementary_genotype mes-2(bn11); unc-4(e120)/mnC1[dpy-10(e128) unc-52(e444)] II" | WBGene00001072(dpy-10)|WBGene00003220(mes-2)|WBGene00006744(unc-4)|WBGene00006787(unc-52) | WBGene00001072(dpy-10), WBGene00003220(mes-2), WBGene00006744(unc-4), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00034436 | WormBase (WB) | WB | available | PMID:1783292 PMID:37818613 |
WB-STRAIN:SS186, CGC_SS186 | 2026-08-15 09:32:38 | 1 | ||
|
SS104 Resource Report Resource Website 10+ mentions |
RRID:WB-STRAIN:WBStrain00034434 | Caenorhabditis elegans | glp-4(bn2) I. | Reference WBPaper00056840 added based on published strain data identified by Textpresso literature search.|"Reference WBPaper00059681 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00060516 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype glp-4(bn2ts) I"|"Temperature sensitive defect in germ-line proliferation during larval development. Defect can be reversed by shifting worms from restrictive (25C) to permissive temperature (16C). Germ-line proliferation defect at restrictive temperature may be due to arrest in mitotic prophase. This strain is very useful for producing large populations of worms that essentially lack a germ line."|"WBStrain mapped, WBPaper00061562 added based on AFP_Strain data." | WBGene00006936(glp-4) | WBGene00006936(glp-4) | WB-STRAIN:WBStrain00034434 | WormBase (WB) | WB | available | PMID:1289064 PMID:31160462 PMID:32451438 PMID:32704017 PMID:33087356 PMID:33498622 PMID:34172445 PMID:36924492 PMID:37474586 PMID:38190406 PMID:38740431 PMID:38908368 PMID:38963038 |
WB-STRAIN:SS104, CGC_SS104 | 2026-08-15 09:32:37 | 11 | ||
|
SS579 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034442 | Caenorhabditis elegans | pgl-1(bn101) IV. | Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%. | WBGene00003992(pgl-1) | WBGene00003992(pgl-1) | WB-STRAIN:WBStrain00034442 | WormBase (WB) | WB | available | PMID:9741628 | WB-STRAIN:SS579, CGC_SS579 | 2026-08-15 09:32:38 | 1 | ||
|
SS580 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034443 | Caenorhabditis elegans | pgl-1(bn102) IV. | Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%. | WBGene00003992(pgl-1) | WBGene00003992(pgl-1) | WB-STRAIN:WBStrain00034443 | WormBase (WB) | WB | available | PMID:9741628 | WB-STRAIN:SS580, CGC_SS580 | 2026-08-15 09:32:37 | 2 | ||
|
SPC167 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034419 | Caenorhabditis elegans | dvIs19 III; skn-1(lax120) IV. | dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37. | WBGene00004804(skn-1) | WBGene00004804(skn-1) | WB-STRAIN:WBStrain00034419 | WormBase (WB) | WB | available | PMID:33228848 PMID:37427543 PMID:39164296 |
WB-STRAIN:SPC167, CGC_SPC167 | 2026-08-15 09:32:37 | 2 | ||
|
STR91 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034518 | Caenorhabditis elegans | kyIs445[Pdes-2::mCherry::RAB-3; Pdes-2::SAD-1::GFP; Podr-1::DsRED];hrtEx23[Pdes-2::GFP::KBP; Pmyo-2::GFP] | EMPTY | WB-STRAIN:WBStrain00034518 | WormBase (WB) | WB | unknown | PMID:26948876 | WB-STRAIN:STR91 | 2026-08-15 09:32:39 | 1 | ||||
|
STE72 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034508 | Caenorhabditis elegans | nhr-80(tm1011) III; nhr-66(ok940) IV. | Made_by: Pranali Pathare|"Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645." | WBGene00003656(nhr-66)|WBGene00003670(nhr-80) | WBGene00003656(nhr-66), WBGene00003670(nhr-80) | WB-STRAIN:WBStrain00034508 | WormBase (WB) | WB | available | WB-STRAIN:STE72, CGC_STE72 | 2026-08-15 09:32:40 | 1 | |||
|
STE73 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034509 | Caenorhabditis elegans | nhr-80(tm1011) III; nhr-13(gk796) V. | Made_by: Pranali Pathare|"Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645." | WBGene00003612(nhr-13)|WBGene00003670(nhr-80) | WBGene00003612(nhr-13), WBGene00003670(nhr-80) | WB-STRAIN:WBStrain00034509 | WormBase (WB) | WB | available | WB-STRAIN:STE73, CGC_STE73 | 2026-08-15 09:32:38 | 1 | |||
|
SU159 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034584 | Caenorhabditis elegans | ajm-1(ok160) X; jcEx44. | Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"jcEx44 [ajm-1::GFP + rol-6(su1006)]. Throws Rollers (weak -- some animals appear nearly wild-type) expressing ajm-1::GFP and dead eggs." | WBGene00000100(ajm-1) | WBGene00000100(ajm-1) | WB-STRAIN:WBStrain00034584 | WormBase (WB) | WB | available | PMID:33309948 | WB-STRAIN:SU159, CGC_SU159 | 2026-08-15 09:32:40 | 1 | ||
|
SX2499 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034646 | Caenorhabditis elegans | prde-1(mj207) V. | piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96. | WBGene00008995(prde-1) | WBGene00008995(prde-1) | WB-STRAIN:WBStrain00034646 | WormBase (WB) | WB | available | WB-STRAIN:SX2499, CGC_SX2499 | 2026-08-15 09:32:42 | 1 | |||
|
TG2435 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034694 | Caenorhabditis elegans | vtIs1 V. | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll well, but GFP expression is easily detected. Reference: Nass R, et al. Proc Natl Acad Sci U S A. 2002 Mar 5;99(5):3264-9. Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767. | WB-STRAIN:WBStrain00034694 | WormBase (WB) | WB | available | PMID:36719882 PMID:37528117 PMID:39950089 PMID:39746999 |
WB-STRAIN:TG2435, CGC_TG2435 | 2026-08-15 09:32:42 | 1 | ||||
|
TG1868 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034680 | Caenorhabditis elegans | slx-1(tm2644) I. | Reference: Agostinho A, et al. PLos Genetics 2013.|"Supplementary_genotype slx-1(tm2644)" | WBGene00018909(slx-1) | WBGene00018909(slx-1) | WB-STRAIN:WBStrain00034680 | WormBase (WB) | WB | available | PMID:36176234 | WB-STRAIN:TG1868, CGC_TG1868 | 2026-08-15 09:32:42 | 1 | ||
|
SV314 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034602 | Caenorhabditis elegans | rol-1(e91) cyd-1(he112)/mnC1 [dpy-10(e28) unc-52(e444)] II. | Heterozygotes are WT and segregate WT, DpyUncs, and rol-1 cyd-1 homozygotes which are thin, sterile, uncoordinated animals. rol-1 is largely suppressed by cyd-1. No postembryoinc cell divisions take place in cyd-1. | WBGene00000870(cyd-1)|WBGene00001072(dpy-10)|WBGene00004394(rol-1)|WBGene00006787(unc-52) | WBGene00000870(cyd-1), WBGene00001072(dpy-10), WBGene00004394(rol-1), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00034602 | WormBase (WB) | WB | available | WB-STRAIN:SV314, CGC_SV314 | 2026-08-15 09:32:41 | 2 | |||
|
SV557 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034606 | Caenorhabditis elegans | cdc-14(he141) II. | Extra cell divisions within several cell lineages.|"Made_by: R.M. Saito" | WBGene00000383(cdc-14) | WBGene00000383(cdc-14) | WB-STRAIN:WBStrain00034606 | WormBase (WB) | WB | available | WB-STRAIN:SV557, CGC_SV557 | 2026-08-15 09:32:42 | 1 | |||
|
TB528 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034657 | Caenorhabditis elegans | ceh-14(ch3) X. | PHA and PHB dye-filling defect. About 50% athermotactic. ch3 deletes exon 3, causes frameshift and premature stop. [NOTE: Miyazaki, et al. (2022) report that this strain carries the fln-2(ot611) mutation in the background.] | WBGene00000438(ceh-14) | WBGene00000438(ceh-14) | WB-STRAIN:WBStrain00034657 | WormBase (WB) | WB | available | PMID:10774727 PMID:37587694 |
WB-STRAIN:TB528, CGC_TB528 | 2026-08-15 09:32:43 | 1 | ||
|
TG12 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034663 | Caenorhabditis elegans | cep-1(lg12501) I; unc-119 (ed4) III; gtIs1[CEP-1::GFP + unc-119 (+)] | gtIs1[CEP-1::GFP + unc-119(+)]. GFP expression in germ line of adult worms (20-40 hours post L4) in the late pacytene area in the nucleus. Also expression in alae and a few nuclei in the pharynx. Compound microscope needed to see staining.|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search." | WBGene00000467(cep-1)|WBGene00006843(unc-119) | WBGene00000467(cep-1), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034663 | WormBase (WB) | WB | available | PMID:31717869 PMID:38483995 |
WB-STRAIN:TG12, CGC_TG12 | 2026-08-15 09:32:43 | 3 | ||
|
TG38 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034665 | Caenorhabditis elegans | aak-2(ok524) | 606bp deletion:Starts at position 3979, deletes exon 3|"Hypersensitive to oxidative stress, heat, and UV. 606 bp deletion from nucleotide 22 of Exon 3 to nucleotide 160 of Intron 3."|"Mutagen:UV/TMP"|"Supplementary_genotype aak-2(gt33)"|"WBStrain mapped, WBPaper00061072 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061110 added based on AFP_Strain data." | WBGene00020142(aak-2) | WBGene00020142(aak-2) | WB-STRAIN:WBStrain00034665 | WormBase (WB) | WB | available | PMID:33602504 PMID:33654835 PMID:34610328 PMID:37782016 |
WB-STRAIN:TG38, CGC_TG38 | 2026-08-15 09:32:42 | 3 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
