Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00034489

Source Database: WormBase (WB)
Affected Genes: WBGene00000100(ajm-1)
Genomic Alteration: WBGene00000100(ajm-1)
Availability: available
Source References: PMID:39212544
Synonyms: ncIs13.
Alternate IDs: WB-STRAIN:ST65, CGC_ST65
Notes: ncIs13 [ajm-1::GFP].

Proper citation: RRID:WB-STRAIN:WBStrain00034489 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034451

Source Database: WormBase (WB)
Affected Genes: WBGene00002059(ife-1)
Genomic Alteration: WBGene00002059(ife-1)
Availability: available
Source References: EMPTY
Synonyms: ife-1(bn127) III.
Alternate IDs: WB-STRAIN:SS712, CGC_SS712
Notes: Made_by: Dunkelbarger/Strome|"Mutagen:UV/TMP"|"Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt"

Proper citation: RRID:WB-STRAIN:WBStrain00034451 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034464

Source Database: WormBase (WB)
Affected Genes: WBGene00004297(rad-51)
Genomic Alteration: WBGene00004297(rad-51)
Availability: available
Source References: EMPTY
Synonyms: rad-51(iow53[GFP::rad-51]) IV/nT1[qIs51] (IV;V).
Alternate IDs: WB-STRAIN:SSM264, CGC_SSM264
Notes: Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes. Balancer is prone to breaking down. If a population contains a mix of bright and dim GFP animals, pick dim GFP and check for correct segregation of progeny to maintain. iow53 inserted a GFP tag at the N-terminus of the endogenous rad-51 locus, but the tagged protein is not fully functional. non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes form GFP foci in the germline that are mostly spo-11 dependent, and GFP::rad-51 homozygotes have defects in unloading RAD-51. Created by CRISPR using pDD282, therefore may also contain 3XFLAG. Reference: Koury E, et al. Nucleic Acids Res. 2018 Jan 25;46(2):748-764.|"Made_by: Matthew Wheat and Emily Koury"

Proper citation: RRID:WB-STRAIN:WBStrain00034464 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034436

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003220(mes-2)|WBGene00006744(unc-4)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003220(mes-2), WBGene00006744(unc-4), WBGene00006787(unc-52)
Availability: available
Source References: PMID:1783292, PMID:37818613
Synonyms: mes-2(bn11) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:SS186, CGC_SS186
Notes: Heterozygotes are WT and segregate WT, DpyUnc and Uncs which give sterile progeny (maternal effect sterile: the progeny from mutant mothers are sterile). The mutation is a strict mel, fully penetrant, and fully expressed. Sterility is due to a failure in germ-cell proliferation.|"Supplementary_genotype mes-2(bn11); unc-4(e120)/mnC1[dpy-10(e128) unc-52(e444)] II"

Proper citation: RRID:WB-STRAIN:WBStrain00034436 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034434

Source Database: WormBase (WB)
Affected Genes: WBGene00006936(glp-4)
Genomic Alteration: WBGene00006936(glp-4)
Availability: available
Source References: PMID:1289064, PMID:31160462, PMID:32451438, PMID:32704017, PMID:33087356, PMID:33498622, PMID:34172445, PMID:36924492, PMID:37474586, PMID:38190406, PMID:38740431, PMID:38908368, PMID:38963038
Synonyms: glp-4(bn2) I.
Alternate IDs: WB-STRAIN:SS104, CGC_SS104
Notes: Reference WBPaper00056840 added based on published strain data identified by Textpresso literature search.|"Reference WBPaper00059681 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00060516 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype glp-4(bn2ts) I"|"Temperature sensitive defect in germ-line proliferation during larval development. Defect can be reversed by shifting worms from restrictive (25C) to permissive temperature (16C). Germ-line proliferation defect at restrictive temperature may be due to arrest in mitotic prophase. This strain is very useful for producing large populations of worms that essentially lack a germ line."|"WBStrain mapped, WBPaper00061562 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00034434 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034442

Source Database: WormBase (WB)
Affected Genes: WBGene00003992(pgl-1)
Genomic Alteration: WBGene00003992(pgl-1)
Availability: available
Source References: PMID:9741628
Synonyms: pgl-1(bn101) IV.
Alternate IDs: WB-STRAIN:SS579, CGC_SS579
Notes: Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%.

Proper citation: RRID:WB-STRAIN:WBStrain00034442 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034443

Source Database: WormBase (WB)
Affected Genes: WBGene00003992(pgl-1)
Genomic Alteration: WBGene00003992(pgl-1)
Availability: available
Source References: PMID:9741628
Synonyms: pgl-1(bn102) IV.
Alternate IDs: WB-STRAIN:SS580, CGC_SS580
Notes: Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%.

Proper citation: RRID:WB-STRAIN:WBStrain00034443 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034419

Source Database: WormBase (WB)
Affected Genes: WBGene00004804(skn-1)
Genomic Alteration: WBGene00004804(skn-1)
Availability: available
Source References: PMID:33228848, PMID:37427543, PMID:39164296
Synonyms: dvIs19 III; skn-1(lax120) IV.
Alternate IDs: WB-STRAIN:SPC167, CGC_SPC167
Notes: dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.

Proper citation: RRID:WB-STRAIN:WBStrain00034419 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034518

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:26948876
Synonyms: kyIs445[Pdes-2::mCherry::RAB-3; Pdes-2::SAD-1::GFP; Podr-1::DsRED];hrtEx23[Pdes-2::GFP::KBP; Pmyo-2::GFP]
Alternate IDs: WB-STRAIN:STR91
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00034518 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034508

Source Database: WormBase (WB)
Affected Genes: WBGene00003656(nhr-66)|WBGene00003670(nhr-80)
Genomic Alteration: WBGene00003656(nhr-66), WBGene00003670(nhr-80)
Availability: available
Source References: EMPTY
Synonyms: nhr-80(tm1011) III; nhr-66(ok940) IV.
Alternate IDs: WB-STRAIN:STE72, CGC_STE72
Notes: Made_by: Pranali Pathare|"Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645."

Proper citation: RRID:WB-STRAIN:WBStrain00034508 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034509

Source Database: WormBase (WB)
Affected Genes: WBGene00003612(nhr-13)|WBGene00003670(nhr-80)
Genomic Alteration: WBGene00003612(nhr-13), WBGene00003670(nhr-80)
Availability: available
Source References: EMPTY
Synonyms: nhr-80(tm1011) III; nhr-13(gk796) V.
Alternate IDs: WB-STRAIN:STE73, CGC_STE73
Notes: Made_by: Pranali Pathare|"Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645."

Proper citation: RRID:WB-STRAIN:WBStrain00034509 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034584

Source Database: WormBase (WB)
Affected Genes: WBGene00000100(ajm-1)
Genomic Alteration: WBGene00000100(ajm-1)
Availability: available
Source References: PMID:33309948
Synonyms: ajm-1(ok160) X; jcEx44.
Alternate IDs: WB-STRAIN:SU159, CGC_SU159
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"jcEx44 [ajm-1::GFP + rol-6(su1006)]. Throws Rollers (weak -- some animals appear nearly wild-type) expressing ajm-1::GFP and dead eggs."

Proper citation: RRID:WB-STRAIN:WBStrain00034584 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034646

Source Database: WormBase (WB)
Affected Genes: WBGene00008995(prde-1)
Genomic Alteration: WBGene00008995(prde-1)
Availability: available
Source References: EMPTY
Synonyms: prde-1(mj207) V.
Alternate IDs: WB-STRAIN:SX2499, CGC_SX2499
Notes: piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.

Proper citation: RRID:WB-STRAIN:WBStrain00034646 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034694

Source Database: WormBase (WB)
Availability: available
Source References: PMID:36719882, PMID:37528117, PMID:39950089, PMID:39746999
Synonyms: vtIs1 V.
Alternate IDs: WB-STRAIN:TG2435, CGC_TG2435
Notes: vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll well, but GFP expression is easily detected. Reference: Nass R, et al. Proc Natl Acad Sci U S A. 2002 Mar 5;99(5):3264-9. Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

Proper citation: RRID:WB-STRAIN:WBStrain00034694 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034680

Source Database: WormBase (WB)
Affected Genes: WBGene00018909(slx-1)
Genomic Alteration: WBGene00018909(slx-1)
Availability: available
Source References: PMID:36176234
Synonyms: slx-1(tm2644) I.
Alternate IDs: WB-STRAIN:TG1868, CGC_TG1868
Notes: Reference: Agostinho A, et al. PLos Genetics 2013.|"Supplementary_genotype slx-1(tm2644)"

Proper citation: RRID:WB-STRAIN:WBStrain00034680 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034602

Source Database: WormBase (WB)
Affected Genes: WBGene00000870(cyd-1)|WBGene00001072(dpy-10)|WBGene00004394(rol-1)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00000870(cyd-1), WBGene00001072(dpy-10), WBGene00004394(rol-1), WBGene00006787(unc-52)
Availability: available
Source References: EMPTY
Synonyms: rol-1(e91) cyd-1(he112)/mnC1 [dpy-10(e28) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:SV314, CGC_SV314
Notes: Heterozygotes are WT and segregate WT, DpyUncs, and rol-1 cyd-1 homozygotes which are thin, sterile, uncoordinated animals. rol-1 is largely suppressed by cyd-1. No postembryoinc cell divisions take place in cyd-1.

Proper citation: RRID:WB-STRAIN:WBStrain00034602 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034606

Source Database: WormBase (WB)
Affected Genes: WBGene00000383(cdc-14)
Genomic Alteration: WBGene00000383(cdc-14)
Availability: available
Source References: EMPTY
Synonyms: cdc-14(he141) II.
Alternate IDs: WB-STRAIN:SV557, CGC_SV557
Notes: Extra cell divisions within several cell lineages.|"Made_by: R.M. Saito"

Proper citation: RRID:WB-STRAIN:WBStrain00034606 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034657

Source Database: WormBase (WB)
Affected Genes: WBGene00000438(ceh-14)
Genomic Alteration: WBGene00000438(ceh-14)
Availability: available
Source References: PMID:10774727, PMID:37587694
Synonyms: ceh-14(ch3) X.
Alternate IDs: WB-STRAIN:TB528, CGC_TB528
Notes: PHA and PHB dye-filling defect. About 50% athermotactic. ch3 deletes exon 3, causes frameshift and premature stop. [NOTE: Miyazaki, et al. (2022) report that this strain carries the fln-2(ot611) mutation in the background.]

Proper citation: RRID:WB-STRAIN:WBStrain00034657 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034663

Source Database: WormBase (WB)
Affected Genes: WBGene00000467(cep-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000467(cep-1), WBGene00006843(unc-119)
Availability: available
Source References: PMID:31717869, PMID:38483995
Synonyms: cep-1(lg12501) I; unc-119 (ed4) III; gtIs1[CEP-1::GFP + unc-119 (+)]
Alternate IDs: WB-STRAIN:TG12, CGC_TG12
Notes: gtIs1[CEP-1::GFP + unc-119(+)]. GFP expression in germ line of adult worms (20-40 hours post L4) in the late pacytene area in the nucleus. Also expression in alae and a few nuclei in the pharynx. Compound microscope needed to see staining.|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."

Proper citation: RRID:WB-STRAIN:WBStrain00034663 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034665

Source Database: WormBase (WB)
Affected Genes: WBGene00020142(aak-2)
Genomic Alteration: WBGene00020142(aak-2)
Availability: available
Source References: PMID:33602504, PMID:33654835, PMID:34610328, PMID:37782016
Synonyms: aak-2(ok524)
Alternate IDs: WB-STRAIN:TG38, CGC_TG38
Notes: 606bp deletion:Starts at position 3979, deletes exon 3|"Hypersensitive to oxidative stress, heat, and UV. 606 bp deletion from nucleotide 22 of Exon 3 to nucleotide 160 of Intron 3."|"Mutagen:UV/TMP"|"Supplementary_genotype aak-2(gt33)"|"WBStrain mapped, WBPaper00061072 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061110 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00034665 Copy   

•   Source: Integrated Animals